Null and Alternatively Expressed Alleles

Assigned as of September 2021

Here are listed all the HLA alleles that have been shown to be either not expressed (Null alleles that have the suffix 'N'), or the alleles that have been shown to be alternatively expressed have the suffix 'L', 'S', 'C', 'A' or 'Q'.

The suffix 'L' is used to indicate an allele that has been shown to have 'Low' cell surface expression when compared to normal levels. The 'S' suffix is used to denote an allele specifying a protein which is expressed as a soluble, 'Secreted' molecule, but is not present on the cell surface. A 'C' suffix is used to indicate an allele product which is present in the 'Cytoplasm', but not on the cell surface. An 'A' suffix is used to indicate an 'Aberrant' expression, specifically where there is some doubt as to whether a protein is expressed at all. A 'Q' suffix is used when the expression of an allele is 'Questionable' given that the mutation seen in the allele has previousÏly been seen in other aleles and shown to affect normal expression levels.

As of March 2018, there are no alleles which have been named with the 'C' or 'A' suffix.

All numbering and descriptions are based on an alignment to the exon sequence of the standard reference allele for that locus e.g. A*01:01:01:01 for null HLA-A alleles. A full explanation of how the mutations are described is provided after the table.

Null Alleles

Allele Mutation Description of Mutation References
A*01:01:01:02N Deletion
Intron 2, g478-481delGTGA, causes translation of intron 2 sequence and an abnormal truncated peptide 
A*01:04:01:01N Insertion
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196Tissue Antigens (1997) 50:347-50
Tissue Antigens (1999) 54:300-2
Tissue Antigens (1999) 54:300-2
Tissue Antigens (1999) 54:300-2
Transplantation (1999) 67:1336-41
 
A*01:04:01:02N Insertion
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 
A*01:11N Point
Exon 3, 968G>T, causes alternative splice site at the end of exon 3 which prevents translation into a correct and stable class I molecule expressed on the cell surfaceHum Immunol (2005) 66:912-20
Hum Immunol (2005) 66:912-20
 
A*01:15N Deletion
Exon 3, 559delC, in codon 163, causes frameshift and premature stop at codon 189Tissue Antigens (2006) 67:61-3
Tissue Antigens (2009) 73:364-72
 
A*01:16N Insertion
Exon 3, 532-533insG, in codon 154, causes frameshift and premature stop at codon 196HLA (2018) 92:304-309
 
A*01:18N Point
Exon 2, 214-216CGG>CCG, causes R48P, which may effect the binding of beta-2 microglobulinAmerican Journal of Clinical Pathology (2004) 122:185-92
 
A*01:22N Deletion
Exon 4, 751delG, in codon 272, causes frameshift and premature stop at codon 272 
A*01:27N Point
Exon 3, 553-555GAG>TAG, causes E161X, a premature stop at codon 161Human Immunology (2008) 68:913-4
 
A*01:31N Point
Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60Tissue Antigens (2010) 76:149-150
 
A*01:52:01N Point
Exon 3, 469-471TGG>TAG, causes W133X, a premature stop at codon 133Tissue Antigens (2014) 83:184-189
 
A*01:52:02N Point
Exon 3, 471G>A, causes W133X, a premature stop at codon 133HLA (2017) 90:79-87
 
A*01:53N Point
Exon 3, 547-549TAC>TAA, causes Y159X, a premature stop at codon 159 
A*01:56N Point
Exon 4, 721-723TGG>TGA, causes W217X, a premature stop at codon 217 
A*01:57N Point
Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
 
A*01:87N Deletion
Exon 4, 723delG, in codon 217, causes frameshift and premature stop at codon 272 
A*01:123N Deletion
Exon 3, 610delC, in codon 180, causes frameshift and premature stop at codon 189Human Immunology (2015) 76:30-35
 
A*01:160N Point
Exon 3, 535C>T, causes Q155X, a premature stop at codon 155 
A*01:162N Point
Exon 2, 286C>T, causes L72X, a premature stop at codon 72HLA (2016) 87:31-35
 
A*01:178N Point
Exon 3, 564C>A, causes C164X, a premature stop at codon 164 
A*01:179N Point
Exon 3, 580A>T, causes R170X, a premature stop at codon 170 
A*01:186N Point
Exon 2, 166C>T, in codon 32, causes Q32X, a premature stop at codon 32 
A*01:240N Point
Exon 2, 235G>T, causes E55X, a premature stop at codon 55 
A*01:247N Insertion
Exon 2, 270insA, in codon 66, causes frameshift and premature stop in codon 74 
A*01:250N Deletion
Exon 2, 261-262delGA, in codons 63-64, causes frameshift and premature stop in codon 73 
A*01:258N Point
Exon 3, 511-513TGG>TGA, causes X147, a premature stop in codon 147 
A*01:269N Point
Exon 2, 232-234CAG>TAG, causes X54, a premature stop in codon 54 
A*01:285N Insertion
Exon 2, 114insCGTCC, in codon 14, causes a frameshift and premature stop at codon 54. 
A*01:287N Insertion
Exon 4, 628insC, in codon 186, causes a frameshift and premature stop in codon 196 
A*01:290N Deletion
Exon 3, 540-541delGA, in codons 156-157, causes a frameshift and premature stop at codon 195 
A*01:293N Insertion
Exon 3, 562-569insAGGGCCGG, in codon 164, causes a frameshift and premature stop at codon 192 
A*01:308N Point
Exon 3, 367-369TAT>TAA, causes Y99X, a premature stop at codon 99HLA (2019) 94:312-312
 
A*01:320N Deletion
Exon 3, 450-466delGAACGAGGACCTGCGCT in codons 126-132, causes frameshift and premature stop at codon 190 
A*01:326N Deletion
Exon 2, 280delC, in codon 70, causes frameshift and premature stop at codon 97 
A*01:328N Point
Exon 4, 742-744CAG>TAG, causes Q224X, a premature stop at codon 224 
A*01:331N Point
Exon 6, 1036-1038, CAG>TAG, causes X322, a premature stop at codon 322 
A*01:336N Deletion
Exon 2, 291-294delTGAC, in codons 73-74, causes frameshift and premature stop at codon 96 
A*01:355N Deletion
Exon 2, 191delCC in codon 40, causes frameshift and premature stop at codon 73 
A*01:361N Point
Exon 3, 415-417CAG>TAG, causes X115, a premature stop at codon 115 
A*01:379N Deletion
Exon 4, 626delC in codon 185, causes frameshift and premature stop at codon 189 
A*01:384N Point
Exon 2, 151-153TAC>TAA, causes X27, a premature stop at codon 27 
A*01:394N Insertion
Exon 3, 507insC, in codon 146, causes a frameshift and premature stop in codon 196 
A*02:15N Point
Exon 4, 841-843TAC>TAA, causes Y257X, a premature stop at codon 257Immunogenetics (1996) 43:1-5
 
A*02:32N Point
Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141Tissue Antigens (2000) 55:31-6
 
A*02:43N Insertion
Exon 4, 779-780insC, in codon 236, causes frameshift and premature stop at codon 264 
A*02:53N Point
Exon 2, 322-324TAC>TAG, causes Y84X, a premature stop at codon 84Tissue Antigens (2002) 59:328-30
 
A*02:82N Point
Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 
A*02:83N Point
Exon 4, 829-831GAG>TAG, causes Q253X, a premature stop at codon 253Tissue Antigens (2005) 66:335-7
 
A*02:88N Point
Exon 3, 418-420GAC>TAG, causes D116X, a premature stop at codon 116 
A*02:94N Deletion
Exon 2, 337delG, in codon 89, causes frameshift and premature stop at codon 126 
A*02:113:01N Point
Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60Tissue Antigens (2008) 72:176-7
Human Immunology (2018) 79:763-772
 
A*02:113:02N Point
Exon 2, 250-252TGG>TGA, causes W60X, a premature stop at codon 60 
A*02:125N Deletion
Exon 2, 261delG, in codon 63, causes a frameshift and premature stop at codon 67Tissue Antigens (2009) 74:424-428
 
A*02:222N Point
Exon 3, 451-453AAA>TAA, causes K127X, a premature stop at codon 127 
A*02:223N Point
Exon 3, 415-417CAG>TAG, causes Q115X, a premature stop at codon 115Tissue Antigens (2014) 83:184-189
 
A*02:225N Point
Exon 3, 439-441TAC>TAA, causes Y123X, a premature stop at codon 123Tissue Antigens (2014) 83:184-189
 
A*02:226N Point
Exon 3, 538-540TTG>TAG, causes L156X, a premature stop at codon 156 
A*02:227N Point
Exon 3, 610-612CAG>TAG, causes Q180X, a premature stop at codon 180Tissue Antigens (2013) 81:46-47
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
 
A*02:250N Deletion
Exon 2, 286-287delCA, in codons 71-72, causes frameshift and premature stop at codon 195 
A*02:284N Point
Exon 3, 391-393TGG>TAG, causes W107X, a premature stop at codon 107 
A*02:301N Deletion
Exon 3, 426delC, in codon 118, causes frameshift and premature stop at codon 118 
A*02:305N Deletion
Exon 4, 814delG, in codon 248, causes frameshift and premature stop at codon 272Tissue Antigens (2012) 79:130-131
 
A*02:314:01N Point
Exon 3, 408-411 TAC>TAG, causes Y113X, a premature stop at codon 113 
A*02:314:02N Point
Exon 3, 408-411 TAC>TAA, causes Y113X, a premature stop at codon 113 
A*02:321N Point
Exon 2, 244-246GAG>TAG, causes Q58X, premature stop at codon 58 
A*02:350N Point
Exon 2, 337-339GAG>TAG causes E89X, a premature stop at codon 89Tissue Antigens (2014) 83:184-189
 
A*02:356N Point
Exon 4, 841-843TAC>TAA, causes Y257X, a premature stop at codon 257Tissue Antigens (2013) 42:136-137
 
A*02:366N Point
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75Tissue Antigens (2014) 83:184-189
 
A*02:373N Point
Exon 3, 514-516GAG>TAG, causes E148X, a premature stop at codon 148 
A*02:395N Point
Exon 2, 268-270AAA>TAA, causes K66X, a premature stop at codon 66Tissue Antigens (2013) 81:451-452
 
A*02:439N Point
Exon 3, 553-555GAG>TAG, causes E161X, a premature stop codon at 161 
A*02:468:01N Point
Exon 3, 571573TGG>TGA, causes W167X, a premature stop codon at 167HLA (2017) 90:171-173
 
A*02:468:02N Point
Exon 3, 571-573TGG>TAG, causes W167X, a premature stop codon at 167 
A*02:476N Point
Exon 3, 511-513TGG>TGA, causes W147X, a premature stop codon at 147HLA (2017) 90:171-173
 
A*02:490N Point
Exon 3, 373-375TGC>TGA, causes C101X, a premature stop codon at 101 
A*02:501N Point
Exon 3, 583-585TAC>TAG, causes Y171X, a premature stop codon at 171 
A*02:506N Insertion
Exon 4, 736-737insG, in codon 222, causes frameshift and premature stop at codon 264 
A*02:514N Point
Exon 2, 247-249TAT>TAG, causes Y57X, a premature stop at codon 59 
A*02:516N Point
Exon 3, 373-375TGC>TGA, causes C101X, a premature stop at codon 101HLA (2016) 87:31-35
 
A*02:525N Point
Exon 2, 151-153TAC>TAA, causes Y27X , a premature stop at codon 27 
A*02:540N Point
Exon 3, 367-369TAT>TAG, causes Y99X, a premature stop at codon 99 
A*02:608N Point
Exon 4, 835-837CAG>TAG, causes Q255X, a premature stop at codon 255 
A*02:622N Point
Exon 3, 418-420TAC>TAA, causes D116X, a premature stop at codon 116HLA (2016) 88:38-38
 
A*02:643N Point
Exon 3, 418-420TAC>TAG, causes Y116X, a premature stop at codon 116HLA (2017) 90:362-364
 
A*02:675N Deletion
Exon 4, 788delG, in codon 239, causes frameshift and premature stop at codon 164HLA (2018) 91:187-194
 
A*02:691N Deletion
Exon 4, 740delA, in codon 223, causes a frameshift and premature stop at codon 272 
A*02:696:01N Point
Exon 3, 549C>A, causes Y159X, a premature stop at codon 159HLA (2020) 96:202-203
 
A*02:696:02N Point
Exon 3, 547-549TAA>TAG, causes X159, a premature stop at codon 159. Is a silent variant of A*02:696N 
A*02:710N Point
Exon 5, 907C>T, causes Q279X mismatch, causes premature stop in codon 279 
A*02:715N Deletion
Exon 2, 91delT, in codon 7, causes frameshift and premature stop in codon 52 
A*02:748N Point
Exon 2, 325-327TAC>TAA, causes X85, a premature stop in codon 85 
A*02:760N Point
Exon 1, 19-21CGA>TGA, causes X-18, a premature stop in codon -18 
A*02:773N Point
Exon 3, 562-564TGC>TGA, causes X164, a premature stop in codon 164 
A*02:775N Point
Exon 3, 433-435AAG>TAG, causes X121, a premature stop in codon 121 
A*02:788N Insertion
Exon 3, 612insTGCA, in codon 180, causes a frameshift and premature stop at codon 197. 
A*02:789N Point
Exon 3, 424-426TAC>TAG, causes X118, a premature stop at codon 118 
A*02:791N Deletion
Exon 4, 817delG, in codon 249, causes a frameshift and premature stop at codon 272. 
A*02:792N Deletion
Exon 5, 941delG, in codon 290, causes a frameshift and premature stop at codon 297 
A*02:793N Deletion
Exon 4, 780delA, in codon 236, causes a frameshift and premature stop at codon 272 
A*02:796N Deletion
Exon 2, 127delG, in codon 19, causes a frameshift and premature stop in codon 52. 
A*02:797N Deletion
Exon 3, 474delC, in codon 134, causes a frameshift and premature stop at codon 156. 
A*02:803N Deletion
Exon 2, 133delC, in codon 21, causes a frameshift and premature stop at codon 52 
A*02:806N Deletion
Exon 2, 78-79delTC, in codons 2-3, causes a frameshift and premature stop at codon 195 
A*02:807N Deletion
Exon 3, 596-606delGGAAGGAGACG, in codons 175-178, causes a frameshift and premature stop at codon 192 
A*02:831N Deletion
Exon 3, 419delA, in codon 116, causes a frameshift and premature stop in codon 126 
A*02:832N Deletion
Exon 4, 675-679delTAGGT, in codons 201-203, causes a frameshift and premature stop in codon X262. 
A*02:833N Insertion
Exon 2, 166insG, in codon 32, causes a frameshift and premature stop at codon 152. 
A*02:858N Deletion
Exon 3, 574delC in codon 168, causes frameshift and premature stop at codon 18 
A*02:871N Deletion
Exon 4, 839-840delGA, in codon 256, causes frameshift and premature stop at codon 263 
A*02:879N Insertion
Exon 3, 523insC, in codon 151, causes frameshift and premature stop at codon 196 
A*02:880N Insertion
Exon 3, 610-613insCAGC, in codon 181, causes frameshift and premature stop at codon 197 
A*02:887N Deletion
Exon 3, 384delG, in codon 104, causes frameshift and premature stop at codon 126 
A*02:895N Insertion
Exon 3, 567insCGTG, in codon 166, causes frameshift and premature stop at codon 197 
A*02:896N Deletion
Exon 5, 913-920delACCATCCC, in codons 281-283, causes frameshift and premature stop at codon 312 
A*02:915N Deletion
Exon 4, 751delG, in codon 227, causes a frameshift and premature stop in codon 272 
A*02:936N Point
Exon 4, 724-726CAG>TAG, causes X218, a premature stop at codon 218 
A*02:945N Deletion
Exon 2, 270delA in codon 66 causes frameshift and premature stop at codon 67 
A*02:946N Deletion
Exon 3, 609delG, in codon 179, causes a frameshift and premature stop in codon 189 
A*02:989N Point
Exon 4, 721-723TGG>TGA, causes X217, a premature stop at codon 217 
A*02:999N Point
Exon 3,571-573TGG>TAG, causes W167X, a premature stop in codon 167 
A*02:1006N Insertion
Exon 4, 881insT, in codon 270, causes a frameshift and premature stop in codon 315 
A*02:1016N Deletion
Exon 3, 574delC in codon 168, causes a frameshift and premature stop at codon 189 
A*02:1031N Deletion
Exon 2, 257delGGGAGACA, in codon 62, causes a frameshift and premature stop at codon 71 
A*03:01:01:02N Point
Intron 4, g1846G>A, causes incorrect splicing and premature stop codon 
A*03:03N Deletion
Exon 3, 373-378delTGCGAC, causes deletion of codons 101-102. Codon 101 is necessary for formation of the disulphide bridgeTissue Antigens (1996) 48:187-91
 
A*03:11N Point
Exon 3, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118 
A*03:21N Insertion
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 
A*03:36N Deletion
Exon 2, 264-290delACACGGAATATGAAGGCCCACTCACAG, deletion of codons 64-73, which affects cell surface expression 
A*03:68N Point
Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at codon 87Tissue Antigens (2014) 83:184-189
 
A*03:69N Point
Exon 3, 538-540CGG>TAG, causes R156X, a premature stop at codon 156Tissue Antigens (2014) 83:184-189
 
A*03:91N Point
Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85Tissue Antigens (2014) 83:184-189
 
A*03:129N Deletion
Exon 4, 651delC, in codon 193, causes frameshift and premature stop at codon 201 
A*03:161N Point
Exon 2, 127-129GAG>TAG, causes E19X, a premature stop at codon 19 
A*03:162N Insertion
Exon 4, 664-665insCATG, in codon 198, causes frame shift and premature stop at codon 199Tissue Antigens (2014) 83:53-54
 
A*03:168N Point
Exon 2, 151-153TAC>TAA, causes Y27X, a premature stop at codon 27Tissue Antigens (2014) 83:195-196
 
A*03:178N Point
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75HLA (2016) 87:31-35
 
A*03:192N Point
Exon 3, 511-513TGG>TGA, causes W147X, a premature stop at codon 147 
A*03:197:01N Point
Exon 3, 409-411TAC>TAG, causes Y113X, a premature stop at codon 113 
A*03:197:02N Point
Exon 3, 409-411, TAG>TAA, causes X113, a premature stop at codon 113 
A*03:262N Deletion
Exon 3, 384-393delGGGGCCGGAC, causing frameshift and premature stop at codon 127HLA (2017) 90:79-87
 
A*03:266N Deletion
Exon 3, 543-544delAG, causes frameshift and premature stop at codon 195HLA (2017) 90:79-87
 
A*03:269N Point
Exon 3, 375C>A, causes C101X, a premature stop at codon 101HLA (2017) 90:79-87
 
A*03:275N Point
Exon 2, 225G>A, causes W51X, a premature stop at codon 51HLA (2017) 90:109-110
 
A*03:279N Deletion
Exon 4, 627delC, in codon 185, causes frameshift and premature stop at codon 189 
A*03:283N Point
Exon 2, 252G>A, causes W60X, a premature stop at codon 60HLA (2018) 91:61-62
 
A*03:284N Deletion
Exon 2, 204delG, in codon 44, causes frameshift and premature stop at codon 52HLA (2017) 90:79-87
 
A*03:286N Point
Exon 3, 508A>T, causes K146X, a premature stop at codon 146 
A*03:297N Point
Exon 3, 610-612CAG>TAG, causes X180, a premature stop in codon 180 
A*03:323N Point
Exon 3, 535-538CAG>TAG, causes X155, a premature stop in codon 155 
A*03:329N Deletion
Exon 2, 155-156delGT, in codon 28, causes a frameshift and premature stop in codon 73 
A*03:330N Deletion
Exon 2, 291-292delTG, in codons 73-74, causes a frameshift and premature stop in codon 151. 
A*03:334N Insertion
Exon 3, 508insC, in codon 146, causes a frameshift and premature stop at codon 152 
A*03:335N Insertion
Exon 2, 160insGTCG, in codon 30, causes frameshift and premature stop at codon 75 
A*03:336N Deletion
Exon 4, 691-703delGGCTTCTACCCTG, in codons 207-211, causes frameshift and premature stop at codon 211 
A*03:337N Insertion
Exon 3, 429-451insCGGCAAGGATTACATCGCCCTGA, in codon 127, causes a frameshift and premature stop at codon 134 
A*03:342N Insertion
Exon 3, 564-567insCGTG, in codon 166, causes a frameshift and premature stop at codon 197 
A*03:357N Insertion
Exon 3, 511insT in codon 147, causes frameshift and premature stop at codon 152 
A*03:364N Deletion
Exon 2, 251delA in codon 59, causes frameshift and premature stop at codon 67 
A*03:374N Deletion
Exon 1, 36-49delACTCTCGGGGGCCC, in codons -13--8, causes frameshift and premature stop at codon 69 
A*03:381N Point
Exon 3, 454-456, GAG>TAG, causes X128, a premature stop at codon 128 
A*03:400N Deletion
Exon 2, 254delA, in codon 61, causes a frameshift and premature stop in codon 67. 
A*03:402N Insertion
Exon 3, 611-614insCAGC in codon 181, causes frameshift and premature stop at codon 197 
A*03:404N Point
Exon 3, 514-516GAG>TAG, causes X148, a premature stop at codon 148 
A*03:408N Insertion
Exon 3, 512insAAGT in codon 147, causes frameshift and premature stop at codon 147 
A*11:21N Insertion
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 
A*11:69N Point
Exon 4, 721-723TGG>TGA, causes W217X, a premature stop at codon 217Tissue Antigens (2014) 83:292-293
 
A*11:78N Deletion
Exon 2, 285-286delAC, causes frameshift and premature stop at codon 73Tissue Antigens (2011) 77:257-258
 
A*11:99N Deletion
Exon 2, 153delC, in codon 27, causes frameshift and premature stop at codon 27 
A*11:109N Point
Exon 3, 511-514TGG>TGA, causesW147X, a premature stop at codon 147 
A*11:115N Point
Exon 2, 151-153TAC>TAA , causes Y27X, a premature stop at codon 27 
A*11:127N Point
Exon 3, 583-585TAC>TAA , causes Y171X, a premature stop at codon 171Tissue Antigens (2014) 84:510-511
 
A*11:137:01N Point
Exon 3, 424-426TAC>TAG, causes Y118X, a premature stop at codon 118Tissue Antigens (2014) 83:184-189
 
A*11:137:02N Point
Exon 3, 426G>A, causes Y118X, a premature stop at codon 118HLA (2017) 90:79-87
 
A*11:180N Deletion
Exon 2, 307delG, in codon 79, causes frameshift and premature stop at codon 97 
A*11:208:01N Point
Exon 2, 223-225TGG>TAG, causes W51X, a premature stop at codon 51 
A*11:208:02N Point
Exon 2, 223-225TAG>TGA, causes W51X, a premature stop at codon 51 
A*11:210N Deletion
Exon 4, 642delC, in codon 190, causes frame shift and premature stop at codon 201Tissue Antigens (2015) 85:502-504
 
A*11:215N Point
Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 
A*11:238N Point
Exon 2, 199-201CAG>TAG, causes Q43X, a premature stop at codon 43 
A*11:251N Insertion
Exon 2, 204-205insAG, in codon 44, causes frameshift and premature stop at codon 53HLA (2018) 92:167-168
 
A*11:287N Point
Exon 2, 295-297CGA>TGA, causes X75, a premature stop in codon 75 
A*11:310N Deletion
Exon 3, 546delC, in codon 158, causes a frameshift and premature stop at codon 189 
A*11:340N Insertion
Exon 2, 164insC in codon 31, causes frameshift and premature stop at codon 74 
A*11:347N Insertion
Exon 1, 73insG, in codon 1, causes a frameshift and premature stop in codon 74 
A*11:365N Deletion
Exon 4, 786delT, in codon 238, causes a frameshift and premature stop in codon 272 
A*11:382N Point
Exon 4, 832-834GAG>TAG. causes E254X, a premature stop in codon 254HLA (2021) 97:448-449
 
A*11:383N Point
Exon 1, 67-69TGG>TAG, causes W-2X, a premature stop in codon -2 
A*11:388N Point
Exon 1, 61CAG>TAG, causes X-6, a premature stop at codon -6 
A*11:397N Point
Exon 3, 547TAC>TAA, in codon 159, causes Y159X, a premature stop in codon 159 
A*11:400N Point
Exon 4, 874-876AAG>TAG, causes X268, a premature stop at codon 268 
A*11:403N Insertion
Exon 1, 73insG, in codon 1, causes a frameshift and premature stop in codon 74 
A*11:407N Insertion
Exon 4 844insTACA, in codon 842, causes a frameshift and premature stop in codon 265 
A*23:07N Insertion
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 
A*23:08N Point
Exon 3, 562-564TGC>TGA, causes c164X, a premature stop at codon 164 
A*23:11N Insertion
Exon 2, 150-151insAGCCCCGCTTCATCGCCGTGGGC, causes frameshift and premature stop at codon 60HLA (2018) 92:304-309
 
A*23:19N Point
Exon 3, 619G>A, in codon 183, mutation occurs at exon boundary, potentially affecting the splice site. Allele shown to be non-expressed.Human Immunology (2015) 76:286-291
 
A*23:38N Deletion
Exon 2, 303delC in codon 77, causes frameshift and premature stop at codon 97Tissue Antigens (2012) 79:71-72
 
A*23:84N Deletion
Exon 2, 116-123delCCGGCCGC, in codons 15-17, causes frameshift and premature stop in codon 70 
A*23:91N Point
Exon 1, 67-69TGG>TGA, causes X-2, a premature stop in codon -2HLA (2018) 92:408-409
 
A*23:103N Point
Exon 4, 892-894, TGG>TAG, causes X274, a premature stop at codon 274 
A*23:106N Deletion
Exon 3, 545delC, in codon 158, causes a frameshift and premature stop in codon 189 
A*23:108N Deletion
Exon 3, 559-574delACGTGCGTGGACGGGC, in codons 163-168, causes frameshift and premature stop at codon 184 
A*23:113N Insertion
Exon 2, 150-151insAGCCCCGCTTCATCGCCGTGGGC, causes frameshift and premature stop at codon 60 
A*24:09N Point
Exon 4, 742-744CAG>TAG, causes Q224X, a premature stop at codon 224J Immunol (1997) 158:5242-50
 
A*24:11N Insertion
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196J Immunol (1997) 158:5242-50
 
A*24:36N Deletion
Exon 2, 252-253delGG, in codon 60-61, causes frameshift and premature stop at codon 60Tissue Antigens (2002) 60:184-5
HLA (2017) 90:79-87
 
A*24:40N Deletion
Exon 4, 626-627delCC, in codon 185, causes frameshift and premature stop codon 195 
A*24:45N Deletion
Exon 2, 101-102delCA, in codon 10, causes frameshift and premature stop codon 73 
A*24:48N Point
Exon 3, 532-534GAG>TAG, causes E154X, a premature stop at codon 154HLA (2018) 92:304-309
 
A*24:60N Point
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 
A*24:83N Point
Exon 4, 697-699TAC>TAA, causes Y209X, a premature stop at codon 209 
A*24:84N Point
Exon 3, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118 
A*24:86N Insertion
Exon 3, 614-615insGAAGGAGACGCTGCAGC, in codon 181, causes frameshift and premature stop codon 195Tissue Antigens (2009) 73:63-65
 
A*24:90:01N Point
Exon 3, 418-420GAC>TAG, causes Y116X, a premature stop at codon 116Tissue Antigens (2010) 76:319-324
Tissue Antigens (2010) 76:319-324
HLA (2018) 92:304-309
HLA (2018) 92:304-309
 
A*24:90:02N Point
Exon 3, 420G>A, causes X116X, a premature stop at codon 116 
A*24:132N Point
Exon 3, 373-375TGC>TGA, causes C101X, a premature stop at codon 101Tissue Antigens (2012) 80:464-465
 
A*24:155N Deletion
Exon 4, 740delA, causes frameshift and premature stop codon at 272Tissue Antigens (2011) 78:267-270
 
A*24:158N Deletion
Exon 3, 453-454delCG, causes frameshift and premature stop at codon 195 
A*24:163N Point
Exon 4/5, 895-897GAG>TAG, causesW275X, a premature stop at codon 275Tissue Antigens (2011) 78:267-270
 
A*24:183N Point
Exon 4, 841-843TAC>TAA, causes Y257X, a premature stop at codon 257Tissue Antigens (2013) 42:136-137
 
A*24:185N Point
Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54 
A*24:222N Deletion
Exon 3, 357delC, in codon 96, causes frame shift and premature stop at codon 97 
A*24:232N Insertion
Exon 2, 113-114insTCCCG, in codon 14, causes a frame shift and a premature stop codon at codon 54 
A*24:240N Point
Exon 2, 322-324TAC>TAG, causes Y84X, a premature stop at codon 84 
A*24:252N Deletion
Exon 2, 282delC, in codon 70, causes a premature stop at codon 97HLA (2017) 90:79-87
 
A*24:278N Point
Exon 3, 547-549TAC>TAG, causes Y159X, a premature stop at codon 159 
A*24:303N Deletion
Exon 3, 487delG, causes frameshift and premature stop at codon 189 
A*24:312N Point
Exon 2, 151-153TAC>TAA, causes Y27X, a premature stop at codon 27 
A*24:323N Point
Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141 
A*24:357N Deletion
Exon 3, 421-431delGCCTACGACGG, deletion of codons 117-119, causes frameshift and premature stop at codon 200HLA (2017) 90:79-87
HLA (2017) 90:79-87
 
A*24:359N Deletion
Exon 2, 249-250delTT deletion causing premature stop at codon 73HLA (2017) 90:79-87
 
A*24:370N Point
Exon 2, 256G>T, causes G62X, a premature stop at codon 62HLA (2017) 90:79-87
 
A*24:388N Point
Exon 3, 856C>T, causes Q262X, premature stop at codon 262HLA (2017) 90:364-365
 
A*24:389N Deletion
Exon 2, 253delG, in codon 61, causes frame shift and premature stop codon at codon 67 
A*24:396N Deletion
Exon 2, 335-338delGCGA deletion in codon 88-89, causes frameshift and premature stop in codon 96 
A*24:408N Point
Exon 3, 502-504AAG>TAG, causes X144, a premature stop in codon 144 
A*24:425N Point
Exon 2, 331-333CAG>TAG, causes X87, a premature stop in codon 87 
A*24:426N Point
Exon 2, 244-246GAG>TAG, causes X58, a premature stop in codon 58 
A*24:427N Deletion
Exon 4, 627delC, in codon 185, causes a frameshift and premature stop at codon 189. 
A*24:428N Point
Exon 2, 250-252TGG>TGA, causes X60, a premature stop at codon 60. 
A*24:429N Insertion
Exon 3, 354insT, in codon 95, causes a frameshift and premature stop at codon 196 
A*24:430N Deletion
Exon 4, 651delC, in codon 193, causes a frameshift and premature stop at codon 201. 
A*24:433N Insertion
Exon 3, 585insA, in codon 171, causes a frameshift and premature stop at codon 171 
A*24:434N Insertion
Exon 2, 128-131insAGCC, in codon 75, causes frameshift and premature stop at codon 75 
A*24:435N Deletion
Exon 2, 286-287delCA, in codon 73, causes frameshift and premature stop at codon 73 
A*24:445N Insertion
Exon 3, 379insCTCCAGATGATGTT, in codon 103, causes a frameshift and premature stop at codon 131 
A*24:448N Point
Exon 6, 1036-1038CAG>TAG, causes X322, a premature stop at codon 322 
A*24:456N Deletion
Exon 3, 560delC in codon 163, causes frameshift and premature stop at codon 18 
A*24:467N Insertion
Exon 4, 628insC, in codon 186, causes a frameshift and premature stop in codon 96 
A*24:514N Deletion
Exon 3, 571delG in codon 167, causes frameshift and premature stop in codon 189HLA (2021) 97:527-529
 
A*24:517N Point
Exon 2, 286-288CAG>TAG, causees Q72>X, a premature stop in codon 72HLA (2021) 97:451-452
 
A*24:518N Insertion
Exon 2, 208insG, in codon 46, causes a frameshift and premature stop in codon 74 
A*24:529N Insertion
Exon 2, 161insG in codon 30, causes frameshift and premature stop at codon 74 
A*24:556N Deletion
Exon 2, 219-295delTGAC, in codon 74, causes a frameshift and premature stop at codon 95 
A*25:12N Point
Exon 3, 547-549TAC>TAA, causes Y159X, a premature stop at codon 159Tissue Antigens (2014) 83:184-189
 
A*25:42N Point
Exon 3, 553G>T, causes E161X, a premature stop at codon 161HLA (2017) 90:79-87
 
A*25:49N Point
Exon 3, 610-612CAG>TAG, causes X180, a premature stop in codon 180 
A*25:69N Deletion
Exon 2, 80delA, in codon 3, causes frameshift and premature stop at codon 5 
A*26:01:01:03N Point
Intron 4, g1846G>A, causes incorrect splicing and premature stop codonHLA (2016) 88:260-261
 
A*26:11N Insertion
Exon 3, 516-517insAC, in codon 149, causes frameshift and premature stop at codon 190 
A*26:25N Insertion
Exon 2, 280-281insC, in codon 70, causes frameshift and premature stop at codon 74 
A*26:60N Point
Exon 3, 424-426>TAC>TAG, causes Y118X, a premature stop at codon 118Tissue Antigens (2014) 83:184-189
 
A*26:71N Point
Exon 2, 223-225>TGG>TAG, causes W51X, a premature stop at codon 51Tissue Antigens (2014) 83:184-189
 
A*26:107N Point
Exon 3, 469-471TGG>TAG, causes W133X, a premature stop at codon 133Tissue Antigens (2015) 85:502-504
 
A*26:127N Point
Exon 3, 532-534GAG>TAG, causes E154X, a premature stop at codon 154 
A*26:145N Point
Exon 2, 232C>T, causes E54X, a premature stop at codon 54 
A*26:161N Insertion
Exon 3, 454insC, in codon 128, causes frameshift and premature stop in codon 152 
A*26:180N Insertion
Exon 3, 666-669insTCTG, in codon 200, causes frameshift and premature stop at codon 265 
A*26:191N Deletion
Exon 4, 751delG, in codon 227, causes frameshift and premature stop at codon 272 
A*26:202N Point
Exon 1, 61-63, CAG>TAG, causes X-4, a premature stop a codon -4 
A*26:206N Point
Exon 3, 393-395TGG>TAG, causes W171X, a premature stop in codon 171HLA (2020) 96:717-718
 
A*26:210N Point
Exon 3, 535-537CAG>TAG, causes X155, a premature stop at codon 155 
A*29:01:01:02N Point
Intron 4, g1846G>T, causes incorrect splicing and premature stop codonTissue Antigens (2002) 59:139-41
 
A*29:08N Point
Exon 2, 223-225TGG>TAG, causes W51X, a premature stop at codon 51 
A*29:78N Point
Exon 2, 286-288CAG>TAG, causes Q72X, a premature stop at codon 72 
A*29:112N Deletion
Exon 2, 286-287delCA in codon 72, causes a frameshift and premature stop in codon 73 
A*30:27N Point
Exon 3, 535-537GAG>TAG, causes Q155X, a premature stop at codon 155 
A*30:59N Point
Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128Tissue Antigens (2013) 82:430-432
 
A*30:70N Deletion
Exon 2, 208-210delG, in codon 46, causes frame shift and premature stop at codon 52HLA (2018) 92:304-309
HLA (2018) 92:304-309
 
A*30:73N Insertion
Exon 3, 516-517insCGGACATGGCGGCTCAGATCACCCAGCGCAAGTGGGAG, in codon 148, causes a frame shift and a premature stop codon at codon 169 
A*30:76N Point
Exon 2, 127-129GAG>TAG, causes E19X, a premature stop at codon 19 
A*30:78N Deletion
Exon2, 188delA, in codon 39, causes a frame shift and premature stop codon at codon 52 
A*30:121N Point
Exon 3, 514G>T, causes E148X a premature stop at codon 148 
A*30:123N Point
Exon 3, 412G>T, causes E114X, a premature stop at codon 114 
A*30:130N Insertion
Exon 4, 628-629insCC, in codon 186, causes frameshift and premature stop in codon 190HLA (2018) 92:324-326
 
A*30:132N Insertion
Exon 4, 628insC in codon 186, causes frameshift and premature stop in codon 196HLA (2018) 92:233-234
 
A*30:145N Insertion
Exon 3, 490insACATGGCG, in codon 140, causes a frameshift and premature stop at codon 159 
A*30:158N Deletion
Exon 3, 509delA in codon 146, causes frameshift and premature stop at codon 156 
A*30:178N Point
Exon 3, 511-513TGG>TGA, causes X147, a premature stop at codon 147 
A*30:197N Point
Exon 3, 598-600AAG>TAG, causes X176, a premature stop in codon 176 
A*31:01:02:03N Deletion
Intron 1, g176-185delGCGGATCTCA, affecting splice site for intron 1 
A*31:14N Insertion
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196Tissue Antigens (2006) 68:526-7
 
A*31:60N Point
Exon 3, 373-375TGC>TGA , causes G101X, a premature stop at codon 101 
A*31:126N Point
Exon 3, 369T>G, causes Y99X, a premature stop at codon 99HLA (2018) 91:534-535
 
A*31:131N Point
Exon 2, 295C>T, causes R75X, premature stop at codon 75 
A*31:141N Insertion
Exon 2, 80insC, in codon 3, causes a frameshift and premature stop in codon 58 
A*31:149N Deletion
Exon 3, 372-382delCTGCGACGTGG, in codons 100-104, causes a frameshift and premature stop at codon 192 
A*31:158N Insertion
Exon 2, 190insG, in codon 40, causes frameshift and premature stop at codon 58 
A*31:184N Point
Exon 1, 67-69TGG>TAG, causes W-2X, a premature stop in codon -2 
A*31:188N Deletion
Exon 3, 481delG in codon 136, causes frameshift and premature stop at codon 156 
A*31:201N Point
Exon 3, 547-549TAC>TAA, causes X159, a premature stop in codon 159 
A*31:202N Point
Exon 2, 247-249TAT>TAA in codon 59, causes a frameshift and premature stop in codon 59 
A*32:19N Point
Exon 3, 571-573GGG>TGA, causes G167X, a premature stop at codon 167Tissue Antigens (2009) 74:553-554
 
A*32:27N Point
Exon 2, 286-288CAG>TAG, causes Q72X, a premature stop at codon 72Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
 
A*32:45N Point
Exon 3, 508-510AAG>TAG, causes K146X, a premature stop at codon 146Tissue Antigens (2014) 83:184-189
 
A*32:48N Point
Exon 3, 409-411 TAC>TAG, causes Y113X, a premature stop at codon 113Tissue Antigens (2014) 83:184-189
 
A*32:56N Deletion
Exon 2, 233delA, in codon 54, causes frameshift and premature stop at codon 67 
A*32:92N Insertion
Exon 3, 617-630insGAGACGCTGCAGCG in codon 181, causes frameshift and premature stop at codon 194HLA (2017) 90:79-87
 
A*32:112N Point
Exon 2, 325-327TAC>TAA, causes X85, a premature stop in codon 85 
A*32:117N Point
Exon 5, 994-996TGG>TAG, causes X308, a premature stop in codon 308 
A*32:126N Deletion
Exon 2, 286-287delCA, in codon 72, causes a frameshift and premature stop at codon 73 
A*32:130N Insertion
Exon 2, 280insC, in codon 70, causes frameshift and premature stop at codon 74 
A*32:132N Point
Exon 3, 373-375TGC>TGA, causes C101X, a premature stop in codon 101 
A*32:133N Insertion
Exon 3, 579insAG, in codon 169, causes frameshift and premature stop at codon 190 
A*32:135N Insertion
Exon 2, 129insA, in codon 19, causes a frameshift and premature stop in codon 37 
A*33:73N Insertion
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196 
A*33:74N Point
Exon 4, 802-804TGG>TAG, causes W244X, a premature stop at codon 244HLA (2017) 90:365-366
 
A*33:80N Point
Exon 3, 424-426TAC>TAG, causes Y118X, a premature stop at codon 118HLA (2017) 90:171-173
 
A*33:96N Point
Exon 3, 469-471TGG>TAG, causes W133X, a premature stop at codon 133 
A*33:123N Deletion
Exon 2, 320delG, in codon 83 causes frameshift and premature stop codon 97HLA (2017) 90:79-87
 
A*33:129N Insertion
Exon 4, 627-628insC, in codon 186 causes frameshift and premature stop at codon 196HLA (2018) 92:243-244
 
A*33:140N Point
Exon 3, 454GAG>TAG, causes E128X, a premature stop in codon 128 
A*33:143N Deletion
Exon 3, 389delA, in codon 106, causes frameshift and premature stop in codon 126 
A*33:154N Point
Exon 2, 325-327TAC>TAA, causes X85, a premature stop in codon 85 
A*33:156N Point
Exon 4, 856-858CAG>TAG, causes X262, a premature stop in codon 262 
A*33:157N Point
Exon 4, 697-699TAC>TAG, causes X209, a premature stop at codon 209 
A*33:174N Deletion
Exon 3, 656-657delCT, in codon 195, causes a frameshift and premature stop at codon 195 
A*33:176N Deletion
Exon 3, 472-485delACCGCGGCGGACAT, in codons 134-138, causes a frameshift and premature stop at codon 191HLA (2019) 94:316-317
 
A*33:194N Point
Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop in codon 141. 
A*33:198N Point
Exon 3, 511-513, TGG>TAG, causes X147, a premature stop at codon 147 
A*33:213N Point
Exon 3, 367-369TAT>TAG, in codon 99, causes Y99X, a premature stop in codon 99 
A*34:10N Point
Exon 3, 415-417CAG>TAG, causes Q115X, a premature stop at codon 115 
A*34:26N Deletion
Exon 4, 779delC, in codon 235, causes a frameshift and premature stop in codon 272 
A*43:02N Deletion
Exon 4, 637-638delAT in codon 189, causes frameshift and premature stop at codon 195 
A*66:27N Point
Exon 2, 327-329TAC>TAA, causes Y85X, a premature stop at codon 85 
A*66:28N Deletion
Exon 4, 627delC, in codon 185, causes a frameshift and premature stop at codon 189HLA (2018) 92:169-170
 
A*66:39N Point
Exon 3, 454-456GAG>TAG, causes E128X, a premature sop in codon 128 
A*68:11N Deletion
Exon 1, 46delG, in codon 9, causes frameshift and premature stop at codon -6Tissue Antigens (1999) 53:573-5
 
A*68:18N Insertion
Exon 2, 213-214insCGAGCCAGAGGATGGAGCCG, between codons 47-48, causes frameshift and premature stop at codon 59Tissue Antigens (2002) 60:88-90
HLA (2017) 90:79-87
 
A*68:49N Point
Exon 3, 511-513TGG>TAG, causes W147X, a premature stop at codon 147Tissue Antigens (2014) 83:184-189
 
A*68:59N Point
Exon 3, 511-513TGG>TAG, causes W147X, a premature stop at codon 147Tissue Antigens (2014) 83:184-189
 
A*68:94N Point
Exon 2, 253-255TGG>TAG , causes W51X, a premature stop at codon 51 
A*68:120N Point
Exon 3, 385-387TCG>TAG, causes S105X, a premature stop at codon 105 
A*68:142N Deletion
Exon 2, 240delG, in codon 56, causes frameshift and premature stop at codon 67 
A*68:171:01N Point
Exon 3, 540G>A, causes W156X, a premature stop at codon 156 
A*68:171:02N Point
Exon 3, 540G>A, causes W156X, a premature stop at codon 156 
A*68:181N Point
Exon 3, 553-555GAG>TAG, causes X161, a premature stop in codon 161 
A*68:182N Point
Exon 3, 358-360CAG>TAG, causes X96, a premature stop in codon 96 
A*68:199N Insertion
Exon 3, 574-587insTGATCCTCATGGGG, in codon 168, causes a frameshift and premature stop at codon 168. 
A*68:203N Deletion
Exon 3, 359delA, in codon 96, causes a frameshift and premature stop at codon 97 
A*68:205N Insertion
Exon 3, 384insG, in coodn 105, causes a frameshift and premature stop at codon 196 
A*68:210N Insertion
Exon 2, 249-262insGTATTGGGACCGGA, in codon 63, causes a frameshift and premature stop at codon 72 
A*68:213N Point
Exon 2, 247-249TAT>TAG in codon 59, causes Y59X, a premature stop at codon 59HLA (2021) 97:60-62
 
A*68:216N Deletion
Exon 1, 61delC in codon -4, causes frameshift and premature stop at codon  
A*68:236N Deletion
Exon 2, 134delG in codon 21, causes frameshift and premature stop at codon 52 
A*68:245N Point
Exon 3, 409-411, TAC>TAA, causes X113, a premature stop at codon 113 
A*68:251N Deletion
Exon 2, 132-133delCC, causes a frameshift and premature stop in codon 71 
A*68:266N Deletion
Exon 2, 213-233delGCGGGCGCCGTGGATAGAGC in codon 47, causes frameshift and premature stop at codon 67. 
A*68:267N Insertion
Exon 2, 228insA in codon 53, causes frameshift and premature stop at codon 74 
A*68:269N Point
Exxon 2, 295-297CGA>TGA, causes X75, a premature stop at codon 75 
A*68:281N Point
Exon 2, 250-252TGG>TGA, causes X60, a premature stop in codon 60 
A*74:12N Deletion
Exon 3, 357-362delCCAGAT, causes deletion of codons 95-97. Protein is not detected at cell surface by pan-class I antibody. 
A*74:14N Point
Exon 2, 223-225TGG>TGA, causes W51X, a premature stop at codon 51 
A*74:32N Point
Exon 3, 424-426TAC>TAG, causes X118, a premature stop in codon 118 
A*80:08N Point
Exon 4, 742-744CAG>TAG, causes Q224X, a premature stop in codon 224 
A*80:09N Point
Exon 3, 454-456GAG>TAG, causes E128X, a premature stop in codon 128 
B*07:44N Point
Exon 4, 852T>G, causes alternative splice site at the end of exon 4 which causes translation of intron 4 sequence and an abnormal truncated peptideHLA (2017) 89:230-234
HLA (2017) 89:230-234
 
B*07:49N Point
Exon 4, 892-894TGG>TAG, causes W274X, a premature stop at codon 274Tissue Antigens (2007) 70:341-3
 
B*07:67N Deletion
Exon 2, 117delC, in codon 15, causes frameshift and premature stop at codon 34 
B*07:111N Point
Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
 
B*07:135N Point
Exon 3, 553-555GAG>TAG, causes G161X, premature stop at codon 161 
B*07:161N Insertion
Exon 5, 961insT, in codon 297, causes a frame shift and premature stop at codon 309Human Immunology (2018) 79:763-772
 
B*07:167N Point
Exon 3, 502-504 CAG-TAG, causes Q144X, a premature stop at codon 144Tissue Antigens (2014) 83:184-189
 
B*07:181N Point
Exon 2, 265-267CAG>TAG, causes Q65X, a premature stop at codon 65Tissue Antigens (2014) 83:184-189
 
B*07:182N Point
Exon 3, 418-420TAC>TAA, causes Y116X, a premature stop at codon 116 
B*07:201N Point
Exon 3, 502-504CAG>TAG, causes Q502X, a premature stop at codon 144 
B*07:231N Point
Exon 2, 322-324TAC>TAG, causes Y84X, a premature stop at codon 84HLA (2016) 87:31-35
 
B*07:251N Deletion
Exon 3, 535delC, in codon 155, causes frameshift and premature stop at codon 189 
B*07:272N Point
Exon 3, 373-375TGC>TGA, causes C101X, a premature stop at 101 
B*07:285N Deletion
Exon 3, 491delC, in codon 140, causes frameshift and premature stop codon 189HLA (2017) 90:79-87
 
B*07:315N Point
Exon 2, 295-297CGA>TGA, causes X75, a premature stop in codon 75 
B*07:316N Deletion
Exon 2, 201-204delGAGA in codons 44 and 45, causes frameshift and premature stop in codon 51 
B*07:318N Point
Exon 2, 166-168CAG>TAG, causes X32, a premature stop in codon 32 
B*07:325N Point
Exon 2, 280-282CAG>TAG, causes X70, a premature stop in codon 70 
B*07:330N Point
Exon 4, 748-750CAG>TAG, causes X226, a premature stop in codon 226 
B*07:343N Deletion
Exon 3, 610-619delGAGCGCGCTG, in codons 180-183, causes a frameshift and premature stop at codon 186 
B*07:351N Deletion
Exon 2, 264delA, in codon 64, causes a frameshift and premature stop at codon 126 
B*07:373N Deletion
Exon 4, 701delC, in codon 210, causes frameshift and premature stop at codon 215 
B*07:374N Deletion
Exon 5, 896-909delAGCCGTCTTCCCAG in codons 275-279, causes frameshift and premature stop at codon 304 
B*07:386N Deletion
Exon 3, 476-619delGCCGCGGACACGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTGAGGCGGAGCAGCGGAGAGCCTACCTGGAGGGCGAGTGCGTGGAGTGGCTCCGCAGATACCTGGAGAACGGGAAGGACAAGCTGGAGCGCGCT, causes the deletion of codons 134-182, which may affect expression 
B*07:415N Point
Exon 2, 100-102TAC>TAG, causes X9, a premature stop at codon 9 
B*07:425N Point
Exon 1, 19-21, CGA>TGA, causes X-19, a premature stop at codon -19 
B*07:435N Insertion
Exon 3, 584insA, in codon 171, causes a frameshift and premature stop in codon 171 
B*07:446N Point
Exon 2, 337-339GAG>TAG, causes X89, a premature stop in codon 89 
B*08:08N Deletion
Exon 3, 473delC, in codon 134, causes frameshift and premature stop at codon 189Tissue Antigens (2000) 55:61-4
 
B*08:19N Point
Exon 4, 724-726CAG>TAG, causes Q218X, a premature stop at codon 218 
B*08:30N Point
Exon 3,424-426TAC>TAA, causes Y118X, a premature stop at codon 118 
B*08:67:01N Point
Exon 2, 223-225TGG>TGA, causes W51X, a premature stop at codon 51 
B*08:67:02N Point
Exon 2, 223-225TGA>TAG, causes W51X, a premature stop in codon 51HLA (2021) 98:55-56
 
B*08:72N Point
Exon 2, 295-297CGA>TGA, causes R75X, premature stop at codon 75Tissue Antigens (2014) 83:184-189
 
B*08:82N Point
Exon 3, 589-591GAG>TAG, causes E173X, a premature stop at codon 173Tissue Antigens (2014) 83:184-189
 
B*08:86N Point
Exon 3, 571-573TGG>TGA, causes W167X, a premature stop at codon 167Tissue Antigens (2014) 83:184-189
 
B*08:148N Deletion
Exon 3, 263-266delCACA, in codons 64-65, causes frameshift and premature stop at codon 125HLA (2017) 90:79-87
 
B*08:214N Insertion
Exon 3, 351insA, in codon 93, causes a frameshift and premature stop at codon 114. 
B*08:215N Deletion
Exon 2, 265-266delCA, in codon 65, causes a frameshift and premature stop at codon 73. 
B*08:220N Point
Exon 2, 250-252TGG>TGA, causes X60, a premature stop at codon 60. 
B*08:236N Point
Exon 4, 832-834GAG>TAG, causes E254X, a premature stop at codon 254 
B*08:252N Point
Exon 3, 637-639, CAG>TAG, causes X181, a premature stop at codon 181 
B*08:279N Point
Exon 3, 583-585TAC>TAG, causes Y171X, a premature stop in codon 171 
B*08:287N Point
Exon 3, 415-418CAG>TAG, causes Q115X, a premature stop at codon 115 
B*13:07N Deletion
Exon 2, 254-268delACCGGAACACACAGA, codons 61-66, causes no frameshift but exon 2 is 5 amino acids shorter 
B*13:49N Point
Exon 3, 439-441TAC>TAA, causes Y123X, premature stop at codon 123Tissue Antigens (2014) 83:184-189
 
B*13:56:01N Point
Exon 3, 424-426TAC>TAA, casues Y118X, premature stop at codon 118Tissue Antigens (2014) 83:184-189
 
B*13:56:02N Point
Exon 3, 424-426TAA>TAG, causes X118X, a premature stop codon at 118 
B*13:63N Insertion
Exon 3, 584-585insA, in codon 171, causes frame shift and premature stop at codon 171Tissue Antigens (2013) 81:459-460
 
B*13:76N Point
Exon 3, 358-360CAG>TAG, causes Q96X, a premature stop at codon 96 
B*13:103N Deletion
Exon 3, 454G>T, causes E128X, a premature stop at codon 128HLA (2019) 94:318-319
 
B*13:116N Point
Exon 5, 907-909CAG>TAG, causes X279, a premature stop at codon 279 
B*13:137N Deletion
Exon 2, 168delG, in codon 32, causes frameshift and premature stop at codon 34 
B*13:139N Point
Exon 4, 682-684, TGG>TGA, causes X204, a premature stop at codon 204 
B*13:161N Deletion
Exon 2, 149delG in codon 26, causes frameshift and premature stop at codon 34. 
B*14:07N Point
Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 
B*14:41N Deletion
Exon 3, 523delC, in codon 151, causing frameshift and premature stop at codon 156Tissue Antigens (2015) 86:208-209
 
B*14:69N Point
Exon 4, 892-894TGG>TGA, causes W274X, a premature stop at codon 274HLA (2020) 96:13-23
 
B*14:72N Point
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop in codon 75 
B*14:76N Point
Exon 4, 682-684TGG>TAG, causes W204X, a premature stop at codon 20 
B*14:78N Insertion
Exon 6, 1030insT in codon 320, causes frameshift and premature stop at codon 33 
B*14:79N Deletion
Exon 3, 352-353delAC in codon 94, causes frameshift and premature stop at codon 113 
B*14:85N Point
Exon 1, 19-21, CGA>TGA, causes X-18, a premature stop at codon -18 
B*14:100N Deletion
Exon 4, 814-815delGG, in codons 247-248, causes a frameshift and premature stop in codon 263 
B*14:101N Deletion
Exon 1, 19delC in codon -18, causes frameshift and premature stop at codon -5 
B*15:01:01:02N Deletion
Intron 1, g175-184delCGGGTCTCAG, affecting splice site for exon 2Tissue Antigens (1999) 53:244-52
 
B*15:26N Point
Exon 3, 367-369TAC>TAA, causes Y99X, a premature stop at codon 99Tissue Antigens (1997) 50:351-4
 
B*15:79N Insertion
Exon 2, 328-329insCA, in codon 86, causes frameshift and premature stop at codon 127 
B*15:94N Point
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 
B*15:111N Deletion
Exon 3, 527-536delAGGCGGAGCA, codons 152-155, causes frameshift and premature stop at codon 186 
B*15:149N Deletion
Exon 2, 264-265delAC, in codons 64-65, causes frameshift and premature stop at codon 113Tissue Antigens (2009) 74:447-449
 
B*15:181N Point
Exon 3, 502-504CAG>TAG, causes Q144X, a premature stop at codon 144Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
 
B*15:182N Point
Exon 2, 91-93TAT>TAG, causes Y7X, a premature stop at codon 7Tissue Antigens (2014) 83:184-189
 
B*15:190N Point
Exon 3, 511-513TGG>TGA, causes W147X, a premature stop at codon 147Tissue Antigens (2014) 83:184-189
 
B*15:209N Point
Exon 3, 469-471TGG>TGA, causes W133X, a premature stop at codon 133Tissue Antigens (2011) 78:267-270
 
B*15:226N Point
Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at 87HLA (2016) 88:201-203
 
B*15:246N Deletion
Exon 2, 264-265delAC, in codon 64-65, causes frameshift and premature stop at codon 113 
B*15:258N Point
Exon 3, 583-585TAC>TAA, causes Y171X, a premature stop at codon 171 
B*15:262:01N Point
Exon 3, 367-369insGACG, in codon 99, causes frameshift and premature stop at codon 115 
B*15:262:02N Insertion
Exon 3, 367-369insGATG, in codon 99, causes a frameshift and premature stop at codon 115 
B*15:272N Point
Exon 3, 424-426TAC>TAG, causes Y118X, a premature stop codon at 118HLA (2017) 90:79-87
 
B*15:294N Point
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75HLA (2016) 87:31-35
 
B*15:302N Deletion
Exon 4, 723delG, in codon 217, causes frameshift and premature stop at codon 314 
B*15:304N Deletion
Exon 2, 137-147delTCATCGCAGTG, in codons 22-25, causes frameshift and a premature stop at codon 110HLA (2017) 90:171-173
 
B*15:375N Deletion
Exon 3, 472-478delACCGCGG, codons 134-136, causes frameshift and premature stop at codon 187HLA (2016) 87:104-106
 
B*15:380N Deletion
Exon 4, 852delT, in codon 261, causes frameshift and premature stop at codon 272 
B*15:400N Deletion
Exon 2, 400-403delCTCC, in codon110, causes frameshift and premature stop at codon 125HLA (2018) 92:100-101
 
B*15:454N Point
Exon 3, 570-572TGG>TAG. causes X167, a premature stopn in codon 167 
B*15:463N Deletion
Exon 3, 437delA, in codon 122, causing a frameshift and a premature stop in codon 126 
B*15:483N Point
Exon 4, 682-684TGG>TAG. causes X204, a premature stop in codon 204 
B*15:487N Deletion
Exon 4, 836delA, in codon 264, causes a frameshift and premature stop in codon 272. 
B*15:496N Deletion
Exon 3, 550delC, in codon 160, causes a frameshift and premature stop in codon 189 
B*15:528N Point
Exon 3, 454-456CAG>TAG, causes E128X, a premature stop in codon 128 
B*15:540N Deletion
Exon 2, 214delC, in codon 47, causes frameshift and premature stop at codon 52 
B*15:544N Deletion
Exon 2, 158delA, in codon 29, causes frameshift and premature stop at codon 34 
B*15:549N Point
Exon 2, 322-324, TAC>TAG, causes X84, a premature stop at codon 84 
B*15:562N Deletion
Exon 3, 579delC in codon 169, causes frameshifte and premature stop at codon 189 
B*15:575N Insertion
Exon 3, 424insT in codon 118, causes frameshift and premature stop at codon 152 
B*15:584N Point
Exon 3, 502-504CAG>TAG, causes X144,a premature stop at codon 144 
B*15:596N Point
Exon 4, 682-684TGG>TAG, causes X204, a premature stop at codon 204 
B*15:604N Deletion
Exon 5, 907delC, in codon 279, causes a frameshift and premature stop in codon 294 
B*18:17N Point
Exon 1, 40-42TCG>TAG, causes W-11X, a premature stop at codon -11Tissue Antigens (2002) 59:341-3
 
B*18:23N Point
Exon 3, 610-612CAG>TAG, causes Q180X, a premature stop at codon 180 
B*18:74N Point
Exon 3, 553-555GAG>TAG, causes E161X, a premature stop at codon 161Tissue Antigens (2014) 83:184-189
 
B*18:94N Point
Exon 2, 291-294TAC>TAA, causes Y74X, a premature stop at codon 74HLA (2016) 87:31-35
 
B*18:138N Deletion
Exon 3, 468-469delCT, in codons 132-133, causes frameshift and premature stop at codon 195 
B*18:154N Point
Exon 3, 511-513TGG>TAG, causes X147, a premature stop in codon 147 
B*18:182N Deletion
Exon 2, 281-282delAC, in codon 70, causes frameshift and premature stop at codon 113. 
B*27:59N Point
Exon 2, 286-288CAG>TAG, causes Q72X, a premature stop at codon 72Tissue Antigens (2011) 78:195-202
 
B*27:64N Point
Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128Tissue Antigens (2014) 83:184-189
 
B*27:65N Point
Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54Tissue Antigens (2014) 83:184-189
 
B*27:66N Deletion
Exon 3, 547delT, in codon 159, causes frame shift and a premature stop at codon 189HLA (2017) 90:171-173
 
B*27:94N Point
Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60 
B*27:176N Point
Exon 3, 598-600AAG>TAG, causes X176, a premature stop in codon 176 
B*27:212N Point
Exon 4, 796-798CAG>TAG, causes Q242X, a premature stop at codon 24 
B*27:223N Deletion
Exon 3, 408delG, in codon 112, causes frameshift and premature stop at codon 126 
B*27:225N Point
Exon 2, 223-225TGG>TGA, causes W51X, a premature stop in codon 51HLA (2021) 97:232-233
 
B*27:243N Point
Exon 2, 232-234CAG>TAG, causes X54, a premature stop at codon 54. 
B*27:246N Point
Exon 2, 256-258CAG>TAG, causes X65, a premature stop at codon 65 
B*35:40N Deletion
Exon 4, 807delA, in codon 245, causes frameshift and premature stop at codon 272Tissue Antigens (2002) 59:522-4
 
B*35:53N Deletion
Exon 3, 473-477delCCGC, in codons 134-135, causes frameshift and premature stop at codon 155 
B*35:129N Point
Exon 2, 286-288CAG>TAG, causes Q72X, a premature stop at codon 72Tissue Antigens (2014) 83:184-189
 
B*35:130N Point
Exon 2, 151-153TAC>TAA, causes Y27X, a premature stop at codon 27Tissue Antigens (2014) 83:184-189
 
B*35:134N Point
Exon 4, 782-784TGG>TGA, causes W224X, a premature stop at 244 
B*35:145N Insertion
Exon 3, 532-533insGCGG, in codon 154 causes a frameshift and premature stop codon at 197 
B*35:165N Point
Exon 3, 373-375TGC>TGA, causes C101X, a premature stop at 101 
B*35:173:01N Point
Exon 2, 222-225TGG>TAG, causes W51X, premature stop at codon 51Tissue Antigens (2014) 83:184-189
 
B*35:173:02N Point
Exon 2, 225G>A, causes W51X, a premature stop at codon 51 
B*35:216N Point
Exon 2, 331-333 CAG-TAG, causes Q87X, a premature stop at codon 87 
B*35:381N Point
Exon 3, 424-426TAC>TAA, causes X118, a premature stop in codon 118 
B*35:390N Point
Exon 1, 40-42TGG>TAG, causes W-11X, a premature stop in codon -11 
B*35:427N Insertion
Exon 3, 617-618insCG, in codon 183, causes a frameshift and premature stop at codon 190 
B*35:430N Deletion
Exon 3, 518delC, in codon 149, causes a frameshift and premature stop at codon 156 
B*35:448N Deletion
Exon 5, 687-693delCCTGGGC in codons 205-207, causes frameshift and premature stop at codon 213 
B*35:453N Deletion
Exon 2, 286-287delCA in codon 72, causes frameshift and premature stop at codon 113 
B*35:456N Point
Exon 4, 841-843TAC>TAA, causes Y257X, a premature stop at codon 257 
B*35:459N Point
Exon 4, 681-684TGG>TGA, causes W204X, a premature stop at codon 204 
B*35:461N Point
Exon 3, 562-564, TGC>TGA, causes C164X, a premature stop in codon 164 
B*35:507N Point
Exon 1, 1-3ATG>TTG, causes a non-synonymous change to the start codon, which may affect expression 
B*35:508N Point
Exon 2, 232C>T, in codon 54, causes Q54X, a premature stop in codon 54 
B*35:513N Point
Exon 3, 571-573, TGG>TGA, causes X167, a premature stop at codon 167 
B*37:03N Point
Exon 2, 337-339GAG>TAG, causes E89X, a premature stop at codon 89 
B*37:30N Point
Exon 3, 469-471TGG>TAG, causes W133X, premature stop at codon 133HLA (2019) 95:128-130
 
B*37:33N Point
Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60Tissue Antigens (2014) 83:184-189
 
B*37:42N Deletion
Exon 2, 213delC, in codon 47, causes a premature stop at codon 52HLA (2017) 90:79-87
 
B*37:79N Deletion
Exon 2, 286-287delCA, in codon 72, causes a frameshift and premature stop at codon 113. 
B*37:82N Deletion
Exon 2, 202-203delCC, in codon 43, causes a frameshift and premature stop at codon 113 
B*37:86N Deletion
Exon 4, 701delC in codon 210, causes frameshift and premature stop at codon 216 
B*37:92N Deletion
Exon 1, 46delG in codon -9, causes X-6, a frameshift and premature stop at codon -6. 
B*38:34N Point
Exon 2, 286-288CAG>TAG, causes Q72X, premature stop at codon 72Tissue Antigens (2014) 83:184-189
 
B*38:80N Deletion
Exon 4, 757-767delGAGCTTGTGGA, in codons 229-232, causes frameshift and premature stop in codon 260 
B*38:83N Deletion
Exon 2, 265-266delCA, in codon 65, causes frameshift and premature stop in codon 113 
B*38:165N Point
Exon 2, 331-333, CAG>TAG, causes X87, a premature stop at codon 87HLA (2020) 96:96-97
 
B*39:25N Deletion
Exon 3, 403-404delGC, in codon 111, causes frameshift and premature stop at codon 113Human Immunology (2018) 79:763-772
 
B*39:40:01N Point
Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164HLA (2020) 96:70-75
 
B*39:40:02N Point
Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 
B*39:87N Point
Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at codon 87HLA (2017) 90:171-173
 
B*39:95N Point
Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141HLA (2016) 87:31-35
 
B*39:97N Insertion
Exon 3, 604-605insGA, in codon 178, causes frameshift and premature stop at codon 190HLA (2016) 88:312-313
 
B*39:116N Point
Exon 2, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118 
B*39:133N Point
Exon 2, 251TGG>TAG, causes W60X, a premature stop in codon 60 
B*39:139N Point
Exon 3, 469-471TGG>TGA, causes X133, a premature stop in codon 133 
B*39:142N Deletion
Exon 2, 365delG, in codon 56, causes a frameshift and premature stop at codon 126. 
B*39:146N Insertion
Exon 2, 88insA, in codon 5, causes a frameshift and premature stop at codon 74 
B*39:147N Insertion
Exon 2, 258insG, in codon 63, causes a frameshift and premature stop at codon 114 
B*39:157N Deletion
Exon 2, 107delT, in codon 12, causes frameshift and premature stop at codon 34 
B*39:161N Deletion
Exon 3, 390-391delCG, in codon 106-107, causes frameshift and premature stop at codon 113 
B*39:175N Point
Exon 4, 664-666GAG>TAG, in codon 198, causes E198X, a premature stop in codon 198 
B*40:22N Point
Exon 2, 244-246GAG>TAG, causes E58X, a premature stop at codon 58Tissue Antigens (2000) 55:378-80
 
B*40:118N Point
Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128Tissue Antigens (2014) 83:184-189
 
B*40:142N Deletion
Exon 2, 253delG, in codon 60, causes frameshift and premature stop at codon 126 
B*40:144N Point
Exon 4, 826-828GGA>TGA, causes G252X, a premature stop at codon 252Tissue Antigens (2011) 78:267-270
 
B*40:155:01N Insertion
Exon 3, 593-594insCAGAA, in codon 174, causes frameshift and premature stop at codon 191Tissue Antigens (2011) 78:154-155
 
B*40:155:02N Insertion
Exon 3, 593-594insCAGAA, in codon 174, causes frameshift and premature stop at codon 191HLA (2017) 90:171-173
 
B*40:216N Deletion
Exon 3, 385delC, in codon 105, causes frameshift and a premature stop at codon 126 
B*40:256N Deletion
Exon 2, 301-302delAG, in codon 77, causes frameshift and a premature stop at codon 113 
B*40:263N Point
Exon 3, 580582AGA>TGA, causes R170X, a premature stop at codon 170HLA (2017) 90:171-173
 
B*40:265N Deletion
Exon 2, 189-196delCGCCACGA, causes frameshift and a premature stop at codon 111HLA (2017) 90:171-173
 
B*40:286N Point
Exon 3, 424-426TAC>TAG, causes Y118X , a premature stop at codon 118HLA (2017) 90:171-173
 
B*40:291N Point
Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 
B*40:337N Point
Exon 3, 367-369TAC>TAA, causes Y99X, a premature stop at codon 99 
B*40:338N Point
Exon 4, 841-843TAC>TAA, causes Y257X, a premature stop at codon 257 () :-
 
B*40:345N Insertion
Exon 3, 508insC, in codon 146, causes frameshift and premature stop codon 196HLA (2017) 90:79-87
 
B*40:361N Point
Exon 2, 331C>T, causes Q87X, premature stop at codon 87 
B*40:372N Insertion
Exon 2, 327insA, in codon 85, causes frameshift and a premature stop in codon 85 
B*40:399N Deletion
Exon 2, 113-116delGGCC, in codons 14 and 15, causes frameshift and premature stop in codon 33 
B*40:426N Deletion
Exon 2, 321delC, in codon 83, causes a frameshift and premature stop at codon 126 
B*40:428N Deletion
Exon 2, 279-282delCAAC, in codon 69-70, causes a frameshift and premature stop at codon 125 
B*40:438N Deletion
Exon 2, 352-353delAC, in codon 94, causes frameshift and premature stop at codon 113 
B*40:481N Deletion
Exon 2, 270delCTCCA in codon 66-68, causes frameshift and premature stop at codon 112 
B*40:483N Point
Exon 4, 835-837CAG>TAG, causes X255, a premature stop at codon 255 
B*40:487N Deletion
Exon 4, 643delC in codon 191, causes frameshift and premature stop at codon 201 
B*40:488N Insertion
Exon 2, 160insG, in codon 30, cause a frameshift and premature stop in codon 114 
B*41:45N Insertion
Exon 2, 279-280insGAGACACAGATCTCCAAGACC, causes no frameshift but allele is shown to be non-expressedHLA (2016) 88:50-51
 
B*44:19N Deletion
Exon 1, 5delT, in codon -23, causes frameshift and a premature stop at codon -6Tissue Antigens (2000) 56:441-5
 
B*44:23:01:01N Point
Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141Eur J Immunogenet (2003) 30:385-6
Tissue Antigens (2003) 61:20-48
 
B*44:23:01:02N Point
Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141 
B*44:52N Deletion
Exon 3, 492-505delTCAGATCACCCAGC, in codons 140-145, causes frameshift and premature stop at codon 191 
B*44:56N Point
Exon 3, 367-369TAC>TAA, causes Y99X, a premature stop at codon 99Tissue Antigens (2009) 73:607-609
 
B*44:58N Point
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75Tissue Antigens (2009) 74:238-240
 
B*44:61N Point
Exon 2, 208-210GAG>TAG, causes E46X, a premature stop at codon 46 
B*44:108N Point
Exon 3, 610-612CAG>TAG, causes Q180X, a premature stop at codon 180Tissue Antigens (2012) 79:50-57
 
B*44:149N Point
Exon 3, 358-360CAG>TAG, causes Q96X, a premature stop at codon 96Tissue Antigens (2014) 83:184-189
 
B*44:171N Point
Exon 2, 259-261GAG>TAG, causes E63X, a premature stop at codon 63Tissue Antigens (2014) 83:184-189
 
B*44:195N Point
Exon 3, 571-573TCG>TAG, causes S167X, a premature stop at codon 167HLA (2016) 87:31-35
 
B*44:198N Point
Exon 3, 424-426TAC>TAG, causes Y118X, a premature stop at codon 118HLA (2016) 87:31-35
 
B*44:217N Point
Exon 3, 415-417CAG>TAG, causes Q115X, a premature stop at codon 115 
B*44:237N Deletion
Exon 2, 286-287delCA, in codon 72, causes frameshift and premature stop at codon 113HLA (2016) 88:126-127
 
B*44:267N Insertion
Exon 4, 627insC, in codon 185, causes frameshift and premature stop at codon 196HLA (2018) 91:187-194
 
B*44:303N Point
Exon 4, 721-723TGG>TAG, causes X217, a premature stop in codon 217. 
B*44:306N Point
Exon 1, 19-21CGA>TGA, causes X-18, a premature stop at codon -18 
B*44:309N Insertion
Exon 1, 47insG, in codon -9, causes a frameshift and premature stop at codon 114. 
B*44:310N Insertion
Exon 4, 627insC, in codon 185, causes a frameshift and premature stop at codon 196. 
B*44:314N Insertion
Exon 3, 584insA, in codon 171, causes a frameshift and premature stop at codon 171 
B*44:328N Point
Exon 2, 235-237GAG>TAG, causes X55, a premature stop in codon 55 
B*44:333N Insertion
Exon 3, 515insA, in codon 148, causes a frameshift and premature stop in codon 196 
B*44:334N Point
Exon 4, 679-681TGC>TGA, causes X203, a premature stop at codon 203 
B*44:341N Insertion
Exon 4, 607-626insAAAGACACATGTGACCCCCC, in codon 185, causes frameshift and premature stop at codon 196 
B*44:345N Deletion
Exon 2, 313-331delCTCCGCGGCTACTACAACC in codons 81-87, causes frameshift and premature stop at codon 120HLA (2020) 96:220-221
 
B*44:438N Insertion
Exon 2, 319-320insAC in codon 83, causes frameshift and premature stop at codon 126 
B*44:448N Point
Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 
B*44:449N Deletion
Exon 2, 212delC in codon 47, causes frameshift and premature stop at codon 52 
B*44:466N Point
Exon 1, 1-3ATG>ACG, causes a non-synonymous change to the start codon, which may affect expression 
B*44:512N Deletion
Exon 3, 626delC in codon 185, causes frameshift and premature stop at codon 189 
B*44:523N Deletion
Exon 4, 626delC, in codon 185, causes a frameshift and premature stop in codon 189 
B*45:28N Deletion
Exon 2, 246delG, in codon 58, causes a frameshift and premature stop at codon 116 
B*46:07N Point
Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164Tissue Antigens (2006) 68:518-20
 
B*46:15N Point
Exon 4,736-738GAG>TAG, causes E222X, a premature stop at codon 222 
B*46:41N Deletion
Exon 2, 268-280delAGCCGAGGCACA, in codon 66-70, causes a frame shift and premature stop codon at 72HLA (2020) 95:212-213
 
B*46:55N Point
Exon 3, 469-471TGG>TAG, causes W133X, a premature stop codon at 133HLA (2017) 90:171-173
 
B*46:79N Deletion
Exon 2, 269delA in codon 66, causes frameshift and premature stop at codon 76 
B*49:19N Point
Exon 3, 469-471TGG>TAG, causes W133X, premature stop at codon 133 
B*49:60N Deletion
Exon 2, 217delG, in codon 49, causes frameshift and premature stop at codon 52 
B*50:72N Point
Exon 2, 265-267CAG>TAG, causes Q65X, a premature stop in codon 65 
B*51:11N Insertion
Exon 4, 627-628insC, in codon 186, causes frameshift and premature stop at codon 196Tissue Antigens (2001) 57:369-72
 
B*51:27N Point
Exon 3, 502-504CAG>TAG, causes Q144X, a premature stop at codon 144Tissue Antigens (2002) 60:262-5
 
B*51:41N Point
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 
B*51:44N Point
Exon 2, 265-267CAG>TAG, causes Q65X, a premature stop codon 65 
B*51:98N Point
Exon 2, 127-129GAG>TAG, causes E19X, a premature stop at codon 19Tissue Antigens (2014) 83:184-189
 
B*51:110N Point
Exon 2, 325-327TAC>TAG, causes Y85X, a premature stop codon 85Tissue Antigens (2014) 83:184-189
 
B*51:118N Deletion
Exon 2, 264-265delAC, in codons 64-65, causes frameshift and premature stop at codon 113 
B*51:149N Deletion
Exon 3, 611delA, in codon 180, causes frame shift and premature stop codon at codon 189 
B*51:178N Point
Exon 2, 244-246GAG>TAG, causes E58X, a premature stop at codon 58HLA (2016) 87:31-35
 
B*51:184N Point
Exon 2, 166-168CAG>TAG, causes Q32X, a premature stop at codon 32 
B*51:235N Point
Exon 3, 511-513TGG>TAG, causes X147, a premature stop in codon  
B*51:245N Point
Exon 2, 265-267CAG>TAG, causes Q65X, a premature stop at codon 65 
B*51:256N Deletion
Exon 4, 743-744delAA, in codon 224, causes a frameshift and premature stop in codon 228 
B*51:264N Deletion
Exon 4, 713delC, in codon 216, causes a frameshift and premature stop at codon 215. 
B*51:273N Deletion
Exon 3, 380delT, in codon 103, causes a frameshift and premature stop at codon 126 
B*51:287N Deletion
Exon 3, 523delC in codon 151, causes frameshift and premature stop at codon 156 
B*51:306N Deletion
Exon 3, 393delG, in codon 107, causes a frameshift and premature stop in codon 126 
B*51:313N Insertion
Exon 3, 507insC in codon 146, causes frameshift and premature stop at codon 152 
B*51:318N Deletion
Exon 2, 300delGA, causes a frameshift and premature stop in codon 113. 
B*51:325N Deletion
Exon 3, 474delC in codon 134, causes frameshift and premature stop at codon 156 
B*51:344N Point
Exon 2, 91-93TAT>TAG, causes Y7X, a premature stop in codon 7 
B*51:357N Deletion
Exon 2, 127delG, in codon 19, causes a frameshift and premature stop at codon 34 
B*52:49N Point
Exon 3, 601-603GAG>TAG, in codon 177, causes E177X, a premature stop at codon 177 
B*52:89N Deletion
Exon 2, 286-287delCA in codon 72, causes frameshift and premature stop at codon 113 
B*52:94N Deletion
Exon 4, 626delC, in codon 185, causes frameshift and premature stop at codon 189 
B*52:96N Point
Exon 3, 493-495, CAG>TAG, causes X141, a premature stop at codon 141 
B*52:103N Point
Exon 4, 892-894, TGG>TAG causes X274, a premature stop at codon 274 
B*53:48N Point
Exon 3, 426C>A, causes Y118X, a premature stop at codon 118 
B*54:05N Deletion
Exon 2, 212-232delCGCGGGCGCCGTGGATAGAGC, in codons 47-54, causes no frameshift but deletion of 7 amino acids 
B*54:08N Point
Exon 3, 553-554GAG>TAG, causes E161X, a premature stop at codon 161Tissue Antigens (2006) 68:182-182
 
B*55:55N Point
Exon 3, 547-549TAC>TAA, causes Y159X, a premature stop at codon 159Tissue Antigens (2014) 83:184-189
 
B*55:83N Point
Exon 4, 799A>T, causes K243X, a premature stop at codon 243HLA (2017) 89:119-120
 
B*55:89N Insertion
Exon 4, 600insA in codon 176, causes frameshift and premature stop in codon 196 
B*55:97N Deletion
Exon 1, 41delC, in codon -9, causes a frameshift and premature stop in codon -6. 
B*55:117N Deletion
Exon 4, 643delC, in codon 191, causes a frameshift and premature stop in codon 201 
B*55:118N Deletion
Exon 2, 268-273delATCTA, in codon 66, causes a frameshift and premature stop at codon 72 
B*56:19N Point
Exon 3, 562-564TGC>TGA, causes C164X, a premature stop at codon 164 
B*56:28N Point
Exon 2, 247-249TGG>TGA, causes W59X, a premature stop at codon 59 
B*56:38N Point
Exon 2, 166-168CAG>TAG, causes Q32X, a premature stop at codon 32Tissue Antigens (2014) 83:184-189
 
B*56:77N Point
Exon 3, 571-573, TGG>TGA, causes X167, a premature stop at codon 167 
B*57:28N Point
Exon 3, 418-420TAC>TAG, causes Y116X, a premature stop at codon 116Int J Immunogenet (2010) 37:299-300
 
B*57:79N Deletion
Exon 4, 876delG, in codon 268, causes frameshift and premature stop at codon 272 
B*57:122N Point
Exon 3, 513-515TGG>TGA, causes W147X, a premature stop at codon 147 
B*57:130N Deletion
Exon 4, 863delA in codon 264, causes frameshift and premature stop at codon 272 
B*57:139N Insertion
Exon 3, 617-618inCG in codon 183, causes frameshift and premature stop at codon 190 
B*57:142N Point
Exon 3, 469-471TGG>TAG, in codon 133, causes W133X, a premature stop in codon 133HLA (2021) 98:380-381
 
B*57:143N Point
Exon 3, 502-504CAG>TAG, causes X144, a premature stop at codon 144 
B*58:10N Deletion
Exon 3, 366delG, in codon 98, causes frameshift and premature stop at codon 126 
B*58:17N Deletion
Exon 3, 311delA, in codon 80, causes frameshift and premature stop at codon 126Tissue Antigens (2009) 73:364-72
 
B*58:31N Deletion
Exon 4, 872-894delCGAAGCCCCTCACCCTGAGATGG, causes frameshift and premature stop at codon 300HLA (2017) 90:171-173
 
B*58:39N Point
Exon 2, 208-210GAG>TAG, causes E46X, a premature stop at codon 46Tissue Antigens (2014) 83:184-189
 
B*58:72N Insertion
Exon 3, 508insC, in codon 146, causes frameshift and premature stop at codon 196HLA (2016) 87:54-55
 
B*58:93N Point
Exon 3, 367-369TAT>TAA, causes Y99X, a premature stop in codon 99 
B*58:94N Point
Exon 3, 571-573TGG>TGA, causes X167, a premature stop in codon 167 
B*58:128N Insertion
Exon 2, 320insG in codon 83, causes frameshift and premature stop at codon 114. 
B*58:130N Insertion
Exon 4, 626insC in codon 185, causes frameshift and premature stop at codon 196 
B*58:133N Deletion
Exon 4, 759delG in codon 229, causes a frameshift and premature stop in codon 272 
B*59:10N Deletion
Exon 3, 506delG, in codons 145, causes frameshift and premature stop at codon 156 
B*81:04N Point
Exon 2, 244-246GAG>TAG, causes E58X, a premature stop at codon 58Tissue Antigens (2009) 73:364-72
 
C*01:37N Point
Exon 3, 361-363TGG>TGA, causes W97X, a premature stop at codon 97 
C*01:56N Point
Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at codon 87 
C*01:69N Point
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75Tissue Antigens (2014) 83:184-189
 
C*01:86N Deletion
Exon 3, 421delG, in codon 117, causes frameshift and premature stop at codon 126HLA (2017) 90:171-173
 
C*01:89N Point
Exon 4, 841-843TAC>TAG, causes Y257X, a premature stop at codon 257HLA (2017) 90:171-173
 
C*01:98N Deletion
Exon 2, 285-286delAC, in codons 72-73, causes frameshift and premature stop at codon 73 
C*01:109N Point
Exon 4, 682-684TGG>TAG, in codon 204, causes S204X, a premature stop at codon 204HLA (2017) 89:252-253
 
C*01:111N Point
Exon 3, 469-471TGG>TAG, causes W133X, a premature stop at codon 133 
C*01:117N Insertion
Exon 2, 203-204insA, in codon 44, causes frameshift and premature stop at codon 74HLA (2018) 92:304-309
 
C*01:137N Deletion
Exon 3, 352-353delAC, in codon 94, causes frameshift and premature stop at codon 113HLA (2018) 91:187-194
 
C*01:143N Point
Exon 3, 585C>A, causes Y171X, a premature stop at codon 171 
C*01:145:01N Point
Exon 3, 420C>A, causes Y116X, a premature stop at codon 116 
C*01:145:02N Point
Exon 3, 418-420, TAA>TAG, causes X116, a premature stop at codon 116 
C*01:171N Deletion
Exon 2, 319delG, in codon 83, causes a frameshift and premature stop at codon 126 
C*01:181N Point
Exon 4, 829-831GAA>TAA causes E253X, a premature stop at codon 25 
C*01:211N Deletion
Exon 2, 240delG in codon 56, causes frameshift and premature stop at codon 76 
C*02:38:01N Point
Exon 3, 367-369TAC>TAA, causes Y99X, a premature stop at codon 99Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
 
C*02:38:02N Point
Exon 3, 367-369TAC>TAG, causes X99, a premature stop at codon 99 
C*02:52N Point
Exon 2, 151-153TAC>TAA, causes Y27X, premature stop at codon 27Tissue Antigens (2014) 83:184-189
 
C*02:92N Deletion
Exon 3, 382delG, in codon 104, causes frameshift and premature stop at codon 126HLA (2017) 90:79-87
 
C*02:105N Insertion
Exon 2, 224-230insTCGCCGT, in codon 51, causes frameshift and premature stop at codon 76 
C*02:121N Point
Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 
C*02:135N Deletion
Exon 3, 538-539delCG, in codon 154, causes frameshift and premature stop in codon 195HLA (2018) 91:538-539
 
C*02:150N Point
Exon 4, 742-744CAA>TAA, causes X224, a premature stop in codon 224 
C*02:165N Deletion
Exon 2, 265-266delCA, in codon 65, causes a frameshift and premature stop at codon 73 
C*02:169N Insertion
Exon 4, 696insG, in codon 205, causes frameshift and premature stop in codon 31 
C*02:192N Point
Exon 3, 571-573, TGG>TAG, causes X167, a premature stop at codon 167 
C*02:193N Point
Exon 4, 682-684TGG>TAG, causesW 204X, a premature stop in codon 204 
C*03:03:01:50N Point
Intron 2, 718A>G, causes a mutation in the splice site preceeding exon 3 
C*03:03:01:52N Point
Intron 1, 203G>A, affecting the splice site for intron 2 
C*03:20N Point
Exon 1, 19-21CGA>TGA, causes R-18X, a premature stop at codon -18 
C*03:23N Point
Exon 3, 406G>A, affecting splice site for intron 2, which causes a frameshift and premature stop codonHLA (2018) 92:304-309
HLA (2020) 95:555-560
 
C*03:121N Point
Exon 3, 511-513TGG>TGA, causes W147X, premature stop at codon 147 
C*03:189N Point
Exon 2, 151-153TAC>TAG, causes Y27X, a premature stop at codon 27 
C*03:201N Point
Exon 3, 583-585TAC>TAG, causes Y171X, a premature stop at codon 171HLA (2017) 90:171-173
 
C*03:208N Point
Exon 2, 271-273TAC>TAA, causes Y67X, a premature stop at codon 67HLA (2017) 90:171-173
 
C*03:224N Point
Exon 4, 727-729TGG>TAG, causes W219X, a premature stop at codon 219HLA (2017) 90:171-173
 
C*03:229N Point
Exon 3, 469-471TGG>TAG, causes W133X, a premature stop at codon 133HLA (2017) 90:171-173
 
C*03:265N Point
Exon 3, 424-426TAC>TAG, causes Y118X, a premature stop at codon 118 
C*03:277N Point
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75 
C*03:316N Deletion
Exon 2, 286-287delCA, causes frameshift and premature stop at codon 73HLA (2019) 95:128-130
 
C*03:318N Point
Exon 3, 418-420TAC>TAA, causes Y116X, a premature stop at codon 116HLA (2017) 90:79-87
HLA (2017) 90:79-87
 
C*03:323N Point
Exon 2, 280-282CAG>TAG, causes Q70X, a premature stop at codon 70 
C*03:363N Point
Exon 2, 225G>A, causes W51X, a premature stop at codon 51 
C*03:366N Deletion
Exon 4, 668-678delCCACCCTGAGG, in codons 199-202, causes frameshift and premature stop at codon 225HLA (2018) 91:187-194
 
C*03:377N Deletion
Exon 2, 299-302delTGAG, in codons 76-77, causes frameshift and premature stop in codon 125 
C*03:380N Point
Exon 4, 895-898GAG>TAG, causes E275X, a premature stop in codon 275 
C*03:391N Insertion
Exon 2, 370insT, in codon 100, causes a frameshift and premature stop in codon 114 
C*03:392N Deletion
Exon 2, 236delA, in codon 55, causing a frameshift and a premature stop in codon 76 
C*03:396:01N Point
Exon 2, 325-327TAC>TAG, causes X85, a premature stop in codon 85 
C*03:396:02N Point
Exon 2, 325-327TAG>TAA, causes X85, a premature stop in codon 85 
C*03:421N Point
Exon 1, 43-45GGA>TGA, causes X-10, a premature stop in codon -10 
C*03:424N Point
Exon 4, 721-723TGG>TAG, causes X217, a premature stop in codon 217 
C*03:432N Point
Exon 4, 721-723TGG>TGA, causes X217, a premature stop in codon 217 
C*03:444N Deletion
Exon 3, 387delC, in codon 105, causes a frameshift and premature stop at codon 126 
C*03:445N Deletion
Exon 3, 586delC, in codon 172, causes a frameshift and premature stop at codon 172 
C*03:446N Insertion
Exon 3, 388insC, in codon 106, causes a frameshift and premature stop at codon 114. 
C*03:447N Deletion
Exon 3, 466delT, in codon 132, causes a frameshift and premature stop at codon 156 
C*03:449N Insertion
Exon 2, 80insC, in codon 3, causes a frameshift and premature stop at codon 74 
C*03:462N Insertion
Exon 3, 394insA, in codon 108, causes a frameshift and premature stop at codon 114. 
C*03:463N Deletion
Exon 3, 421-422delGC, in codon 117, causes frameshift and premature stop in codon 151 
C*03:470N Point
Exon 1, 19C>T, in codon -18, causes CGA>TGA, a premature stop at codon -18 
C*03:508N Deletion
Exon 2, 145delG in codon 25, causes frameshift and premature stop at codon 76 
C*03:509N Deletion
Exon 2, 149delG in codon 26, causes frameshift and premature stop at codon 76 
C*03:510N Point
Exon 1, 127-129, GAG>TAG, causes X19, a premature stop at codon 19 
C*03:511N Insertion
Exon 2, 241insG in codon 241, causes frameshift and premature stop at codon 74 
C*03:531N Deletion
Exon 2, 265delCA, in codon 65, causes a frameshift and premature stop in codon 73 
C*03:560N Deletion
Exon 4, 679delT in codon 203, causes a frameshift and premature stop at codon 215 
C*03:571N Insertion
Exon 3, 430insT, in codon 120, causes a frameshift and premature stop in codon 152 
C*04:09N Deletion
Exon 7, 1095delA, in codon 341, causes frameshift and loss of stop codon in exon 8, resulting in the peptide containing an additional 32 amino acidsHuman Immunology (2002) 63:295-300
Tissue Antigens (2002) 59:95-100
Tissue Antigens (2002) 59:95-100
Human Immunology (2013) 74:325-329
 
C*04:61N Deletion
Exon 7, 1095delA, in codon 341, causes frameshift and loss of stop codon in exon 8, resulting in the peptide containing an additional 32 amino acidsTissue Antigens (2014) 83:184-189
 
C*04:88N Point
Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at codon 87Tissue Antigens (2014) 83:184-189
 
C*04:93N Point
Exon 3, 373-375TGC>TGA, causes C101X, premature stop at codon 101Tissue Antigens (2014) 83:184-189
 
C*04:95N Point
Exon 3, 547-549TAC>TAA, causes W159X, premature stop at codon 159Tissue Antigens (2014) 83:184-189
 
C*04:105N Point
Exon 2, 247-249TAT>TAG, causes Y59X, a premature stop at codon 59Tissue Antigens (2014) 83:184-189
 
C*04:115N Point
Exon 2, 49-51GAG>TAG, causes A49X, a premature stop at codon 49Tissue Antigens (2014) 83:184-189
 
C*04:123N Point
Exon 2, 115-117CAG>TAG, causes Q115X, a premature stop at codon 115 
C*04:170N Point
Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 
C*04:173N Point
Exon 2, 268-270AAG>TAG, causes K66X, a premature stop at codon 66 
C*04:191N Point
Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60 
C*04:203N Point
Exon 3, 511-513TGG>TGA, causes W147X, a premature stop at codon 147 
C*04:205N Point
Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54 
C*04:215N Point
Exon 2, 271-273TAC>TAG, causes Y67X, a premature stop at codon 67 
C*04:217N Deletion
Exon 2, 208delG, in codon 46 causes frameshift and premature stop at codon 76 
C*04:225N Point
Exon 2, 265-267CAG>TAG, causes E65X, a premature stop at codon 65 
C*04:233N Point
Exon 2, 127-129GAG>TAG, causes E19X, a premature stop at codon 19 
C*04:234N Point
Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128HLA (2017) 90:79-87
 
C*04:236N Deletion
Exon 2, 218delA, in codon 49 causes frameshift and premature stop at codon 76HLA (2017) 90:79-87
 
C*04:253N Point
Exon 3, 532-534GAG>TAG causes R154X, a premature stop at codon 154 
C*04:255N Insertion
Exon 2, 194-195insC, in codon 41, causes frameshift and premature stop at codon 74 
C*04:279N Point
Exon 2, 295C>T, causes R75X, a premature stop at codon 75 
C*04:300N Point
Exon 2, 271-273TAC>TAG, causes Y67X, a premature stop at codon 67 
C*04:305N Deletion
Exon 3, 496delA, in codon 142, causes a frameshift and a premature stop in codon 189 
C*04:309N Point
Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 
C*04:349N Insertion
Exon 3, 518-519insCG, in codon 150, causes a frameshift and premature stop at codon 190 
C*04:350N Deletion
Exon 2, 267-274delGAAGTACA, in codons 65-68, causes a frameshift and premature stop at codon 71 
C*04:362N Point
Exon 2, 151-153TAC>TAG, causes X27, a premature stop at codon 27 
C*04:364N Insertion
Exon 2, 267insA, in codon 65, causes a frameshift and premature stop at codon 74 
C*04:365N Deletion
Exon 2, 331delC, in codon 87, causes a frameshift and premature stop at codon 126 
C*04:369N Deletion
Exon 3, 568delG, in codon 166, causes a frameshift and premature stop at codon 189. 
C*04:371N Point
Exon 2, 112-114TGG>TGA, causes W14X, a premature stop in codon 14 
C*04:374N Deletion
Exon 3, 365delT, in codon 98, causes a frameshift and premature stop in codon 126 
C*04:377N Deletion
Exon 2, 127delG in codon 19, causes frameshift and premature stop at codon 76 
C*04:385N Deletion
Exon 3, 393delG in codon 107, causes frameshift and premature stop at codon 126 
C*04:396N Insertion
Exon 2, 239insG, in codon 56, causes a framshift and premature stop at codon 74 
C*04:410N Point
Exon 2, 274-276, AAG>TAG, causes X68, a premature stop at codon 68 
C*04:411N Point
Exon 4, 727-729, TGG>TAG, causes X219, a premature stop at codon 219 
C*04:417N Deletion
Exon 2, 159delC in codon 29, causes frameshift and premature stop at codon 76 
C*04:436N Point
Exon 2, 250-252TGG>TAG, causes X60, a premature stop at codon 60 
C*04:452N Point
Exon 4, 243-245TGG>TAG, causes W244X, a premature stop in codon 244 
C*05:07N Deletion
Exon 3, 352-353delAC, in codon 94, causes frameshift and premature stop at codon 113HLA (2017) 90:79-87
 
C*05:48N Point
Exon 2, 166-168CAG>TAG, causes Q32X, a premature stop at codon 32Tissue Antigens (2014) 83:184-189
 
C*05:91N Point
Exon 2, 337-339GAG>TAG, causes E89X, a premature stop at codon 89 
C*05:92N Point
Exon 2, 175-177CAG>TAG, causes Q35X, a premature stop at codon 35HLA (2017) 90:79-87
 
C*05:99N Deletion
Exon 3, 384delG, in codon 104, causes frameshift and premature stop at codon 126Tissue Antigens (2014) 84:420-421
 
C*05:113N Deletion
Exon 2, 93-94delTT, in codons 7-8, causes frameshift and premature stop at codon 73 
C*05:128N Deletion
Exon 3, 461-474delTGCGCTCCTGGACC, in codons 130-134, causes frameshift and premature stop at codon 147HLA (2018) 92:304-309
 
C*05:153N Point
Exon 1, 61G>T, causes E-4X, premature stop at codon -4 
C*05:154N Point
Exon 3, 514G>T, causes E148X, premature stop at codon 148 
C*05:169N Point
Exon 2, 244-246GAG>TAG, causes X58, a premature stop in codon 58 
C*05:175N Point
Exon 3, 358-360CAG>TAG, causes X94, a premature stop in codon 96 
C*05:180N Point
Exon 3, 424-426TAC>TAG, causes X118, a premature stop in codon 118 
C*05:208N Insertion
Exon 3, 507insC, in codon 146, causes a frameshift and premature stop at codon 152 
C*05:213N Insertion
Exon 3, 466insT, in codon 132, causes a frameshift and premature stop at codon 152 
C*05:239N Point
Exon 4, 682-684, TGG>TAG, causes W204X, a premature stop at codon 204. 
C*05:244N Point
Exon 3, 511TGG>TAG, causes W147X, a premature stop in codon 147 
C*05:251N Insertion
Exon 3, 548insTA in codon 159, causes frameshift and premature stop at codon 190 
C*05:253N Point
Exon 2, 280-282CAG>TAG, in codon 70, causes Q70X, a premature stop in codon 70 
C*05:257N Deletion
Exon 3, 563delG in codon 164, causes frameshift and premature stop at codon 189 
C*05:259N Point
Exon 3, 469-471TGG>TAG, causes W133X, a premature stop in codon 133 
C*05:260N Point
Exon 4, 697-698TAC>TAA, causes Y209X, a premature stop in codon 209 
C*05:263N Deletion
Exon 2, 246delG, in codon 58, causes a frameshift and premature stop in codon 76 
C*06:16N Deletion
Exon 3, 499-500delAC, in codon 143, causes a frameshift and premature stop at codon 151Tissue Antigens (2007) 70:441-2
HLA (2017) 90:79-87
 
C*06:46N Point
Exon 4, 742-744CAA>TAA, causes Q224X, a premature stop at codon 224 
C*06:49N Point
Exon 3, 373-375TGC>TGA, causes C101X, a premature stop at codon 101Tissue Antigens (2014) 83:184-189
 
C*06:79N Point
Exon 3, 538-540TGG>TGA, causes R156X, a premature stop at codon 156 
C*06:116N Deletion
Exon 3, 615-619delCGCGG, in codon 181, causes a premature stop at codon 194HLA (2017) 90:171-173
 
C*06:128N Point
Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54 
C*06:134N Point
Exon 2, 265-267CAG>TAG, causes Q65X, a premature stop at codon 65 
C*06:152N Point
Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128 
C*06:171:01:01N Point
Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85HLA (2017) 90:79-87
 
C*06:171:01:02N Point
Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 
C*06:175N Point
Exon 3, 511-513TGG>TGA, causes W147X, a premature stop at codon 147 
C*06:208N Point
Exon 3, 585C>G, causes Y171X, a premature stop at codon 171 
C*06:211:01:01N Point
Exon 4, 894G>A, causes W274X, a premature stop at codon 274HLA (2019) 94:347-359
 
C*06:211:01:02N Point
Exon 4, 894G>A, causes W274X, a premature stop at codon 274 
C*06:215N Deletion
Exon 3, 568delG, in codon 166, causes frameshift and premature stop in codon 189 
C*06:220N Insertion
Exon 3, 572insT, in codon 167, causes a frameshift and a premature stop in codon 196 
C*06:257N Insertion
Exon 3, 520insG, in codon 150, causes a frameshift and premature stop at codon 189 
C*06:259N Insertion
Exon 2, 164insC, in codon 31, causes a frameshift and premature stop at codon 74 
C*06:263N Deletion
Exon 3, 488delC, in codon 139, causes a frameshift and a premature stop in codon 189 
C*06:267N Insertion
Exon 3, 559-560insGC, in codon 163, causes frameshift and premature stop at codon 190 
C*06:281N Deletion
Exon 2, 269delA, in codon 66, causes frameshift and premature stop at codon 76. 
C*06:301N Point
Exon 3, 468-470, TGG>TAG, causes X133, a premature stop at codon 133 
C*06:309N Point
Exon 2, 229-231GAG>TAG, causes E53X, a premature stop in codon 53 
C*06:316N Point
Exon 3, 598-601AAG>TAG, causes K176X, a premature stop in codon 176 
C*06:323N Point
Exon 3, 562-564TGC>TGA, in codon 164, causes C164X, a premature stop in codon 164 
C*07:02:01:17N Point
Intron 3, g710T>A, causes incorrect splicing and premature stop codonHLA (2018) 92:56-57
 
C*07:32N Insertion
Exon 3, 560-561insCGCAGAT, in codon 163, causes frameshift and premature stop at codon 198HLA (2017) 90:79-87
 
C*07:33N Deletion
Exon 2, 92delA, in codon 7, causes frameshift and premature stop at codon 76Tissue Antigens (2008) 71:560-3
 
C*07:55N Point
Exon 3, 409-411TAT>TAG, causes Y113X, a premature stop at codon 113Tissue Antigens (2012) 79:139-139
Human Immunology (2018) 79:763-772
 
C*07:61N Point
Exon 2, 280-282CAG>TAG, causes Q70X, a premature stop at codon 70 
C*07:98N Point
Exon 3, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141Tissue Antigens (2014) 83:184-189
 
C*07:104N Point
Exon 3, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118Tissue Antigens (2014) 83:184-189
 
C*07:152N Point
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75Tissue Antigens (2014) 83:184-189
 
C*07:164N Point
Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 
C*07:191N Point
Exon 3, 454-456GAG>TAG, causes E128X, a premature stop at codon 128Tissue Antigens (2014) 83:184-189
 
C*07:198N Point
Exon 2, 202-204AGA>TGA, causes R44X, a premature stop at codon 44 
C*07:227N Point
Exon 2, 124-126GGA>TGA, causes 18GX, a premature stop at codon 18 
C*07:264N Point
Exon 3, 535-537CAG>TAG, causes Q155X, a premature stop at codon 155 
C*07:329N Point
Exon 3, 610-612CAG>TAG, causes Q180X, a premature stop at codon 180HLA (2016) 87:31-35
 
C*07:347N Deletion
Exon 3, 537delG, in codon 155, causes frameshift and premature stop at codon 156HLA (2017) 90:171-173
 
C*07:350N Insertion
Exon 4, 706-707insG, in codon 212, causes a frame shiftHLA (2017) 90:171-173
 
C*07:393N Deletion
Exon 3, 564delC, in codon 158, causes frameshift and premature stop at codon 189Tissue Antigens (2015) 85:511-512
 
C*07:437N Deletion
Exon 2, 265-266delCA, in codon 65, causes frameshift and premature stop at codon 73 
C*07:451N Point
Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85 
C*07:452N Point
Exon 2, 208-210GAG>TAG, causes E46X, a premature stop at codon 46 
C*07:476N Point
Exon 2, 265-267CAG>TAG, causes Q85X, a premature stop at codon 85 
C*07:483N Point
Exon 3, 553-555GAG>TAG, causes E161X, a premature stop at codon 161HLA (2017) 90:79-87
 
C*07:484N Point
Exon 3, 415-417CAG>TAG, causes Q115X, a premature stop at codon 115 
C*07:491:01N Point
Exon 3, 469-471TGG>TAG, causes W133X, a premature stop at codon 133 
C*07:491:02N Point
Exon 3, 469-471TAG>TGA, causes X133X, a premature stop at codon 133HLA (2017) 90:79-87
 
C*07:507N Point
Exon 2, 259-261GAG>TAG, causes E63X, a premature stop at codon 63HLA (2017) 90:79-87
 
C*07:551N Deletion
Exon 3, 596-606delGGAAGGAGACG causing frameshift and premature stop at codon 192HLA (2017) 90:79-87
 
C*07:593N Point
Exon 4, 893G>A, causes W148X, premature stop at codon 148 
C*07:600:01N Point
Exon 2, 224G>A, causes W51X, a premature stop at codon 51 
C*07:600:02N Point
Exon 2, 225G>A, causes W51X, a premature stop at codon 51 
C*07:603N Point
Exon 2, 225G>A, causes W51X, at premature stop at codon 51 
C*07:633N Point
Exon 3, 562-564TGC>TGA, causes X164, a premature stop in codon 164 
C*07:672N Insertion
Exon 2, 96-97insTT, in codon 8, causes frameshift and premature stop in codon 77 
C*07:675N Point
Exon 4, 856-858CAG>TAG, causes X262, a premature stop in codon 262 
C*07:686N Point
Exon 4, 721-723TGG>TAG, causes X217, a premature stop in codon 217 
C*07:690N Point
Exon 3, 571-573TGG>TGA, causes X167, a premature stop in codon 167 
C*07:702N Point
Exon 2, 426-428TAC>TAG, causes X118, a premature stop at codon 118 
C*07:726N Deletion
Exon 3, 352-353delAC, in codon 94, causes frameshift and premature stop in codon 113 
C*07:733N Point
Exon 3, 454-456GAG>TAG, causes X128, a premature stop at codon 128 
C*07:743N Deletion
Exon 4, 871delC, in codon 266, causes a frameshift and premature stop at codon 272 
C*07:745N Deletion
Exon 2, 177-178delGT, in codon 35-36, causes a frameshift and premature stop at codon 73 
C*07:746N Deletion
Exon 3, 359-365delAGAGGAT, in codons 96-98, causes a frameshift and premature stop at codon 124 
C*07:747N Deletion
Exon 3, 352-353delAC, in codon 94, causes a frameshift and premature stop at codon 113. 
C*07:749N Deletion
Exon 2, 216delT, in codon 51, causes a frameshift and premature stop at codon 76 
C*07:750N Insertion
Exon 2, 242insC, in codon 57, causes a frameshift and premature stop at codon 74.  
C*07:751N Insertion
Exon 2, 185insA, in codon 38, causes frameshift and premature stop at codon 74 
C*07:752N Insertion
Exon 2, 204insA, in codon 45, causes frameshift and premature stop at codon 74 
C*07:753N Insertion
Exon 2, 173insT, in codon 34 causes a frameshift and premature stop at codon 74. 
C*07:754N Insertion
Exon 3, 584insA, in codon 171, causes a frameshift and premature stop at codon 171 
C*07:770N Point
Exon 3, 598-600AAG>TAG, causes K176X, a premature stop at codon 176 
C*07:773N Insertion
Exon 2, 267insT, in codon 66, causes frameshift and premature stop at codon 66 
C*07:776N Deletion
Exon 3, 352-353delAC, in codon 94, causes frameshift and premature stop in codon 113 
C*07:787N Insertion
Exon 3, 584insA in codon 171, causes frameshift and premature stop at codon 171 
C*07:796N Deletion
Exon 4, 737delA in codon 222, causes frameshift and premature stop at codon 272 
C*07:797N Point
Exon 4, 892-894TGG>TGA, causes W274X, a premature stop at codon 274 
C*07:804N Deletion
Exon 3, 565delG, in codon 165, causes frameshift and premature stop at codon 189. 
C*07:807N Insertion
Exon 4, 899insC, in codon 276, causes frameshift and premature stop at codon 310 
C*07:808N Point
Exon 7, 1075-1077GAG>TAG, causes E335X, a premature stop at codon 335 
C*07:820N Point
Exon 3, 508-510, AAG>TAG, causes X146, a premature stop at codon 146 
C*07:821N Insertion
Exon 2, 166-167insGC, in codon 32, causes frameshift and premature stop at codon 77 
C*07:833N Point
Exon 4, 697-699, TAC>TAA causes X209, a premature stop at codon 209 
C*07:839N Deletion
Exon 3, 352-353delAC, in codon 94, causes frameshift and premature stop at codon 113HLA (2020) 95:142-143
 
C*07:840N Point
Exon 4, 700-702, TAC>TAA, causes X209, a premature stop at codon 209HLA (2020) 96:99-101
 
C*07:849N Deletion
Exon 2, 267delG in codon 65, causes frameshift and premature stop at codon 76 
C*07:856N Point
Exon 3, 580-582, AGA>TGA, causes X170, a premature stop at codon 170 
C*07:863N Deletion
Exon 3, 388-389delGA, causes X113, a frameshift and premature stop at codon 113. 
C*07:881N Deletion
Exon 3, 434delA in codon 121, causes a frameshift and premature stop at codon 126 
C*07:886N Point
Exon 4, 829-831CAA>TAA, causes E253X, a premature stop in codon 253 
C*07:889N Deletion
Exon 2, 185delG, in codon 38, causes a frameshift and premature stop in codon 76 
C*07:934N Point
Exon 4, 736-738GAG>TAG, causes X222, a premature stop at codon 222. 
C*07:936N Deletion
Exon 2, 92delA, in codon 7, causes frameshift and premature stop at codon 76 
C*07:954N Insertion
Exon 2, 295insC in codon 75, causes frameshift and premature stop at codon 114 
C*07:963N Point
Exon 2, 271-273TAC>TAG, causes Y67X, a premature stop in codon 67 
C*07:970N Deletion
Exon 2, 91-128delTATTTCGACACCGCCGTGTCCCGGCCCGGCCGCGGAG in codon 7, causes a frameshift and premature stop at codon 64 
C*08:26N Point
Exon 3, 439-441TAC>TAG, causes Y123X, a premature stop codon at 123Tissue Antigens (2011) 77:54-61
 
C*08:36N Point
Exon 3, 439-441TAC>TAG, causes Y123X, a premature stop at codon 123HLA (2017) 90:171-173
 
C*08:52N Deletion
Exon 4, 678delG, in codon 202, causes frameshift and premature stop at codon 215 
C*08:55N Point
Exon 2, 175-178CGG>TAG, causes R35X, a premature stop at codon 35 
C*08:88N Deletion
Exon 3, 421-427delGCCTACG, in codon 117-119, causes a frame shift and premature stop at codon 124 
C*08:89N Insertion
Exon 2, 133>134InsC, in codon 21, causes a frame shift and premature stop at codon 74 
C*08:121N Deletion
Exon 2, 265-266delCA, in codon 65, causes frameshift and premature stop at codon 73HLA (2016) 87:55-56
 
C*08:127N Insertion
Exon 3, 434-435insG, in codon 121, causes frameshift and premature stop at codon 128 
C*08:129N Insertion
Exon 3, 437-438insA, in codon 121, causes frameshift and premature stop at codon 128 
C*08:130N Point
Exon 2, 208-210GAG>TAG, causes E46X, a premature stop at codon 46 
C*08:161N Insertion
Exon 2, 155-186insGGAGAGCCCCGCTTCATCGCAGTGGGCTACG, in codon 28, causes frameshift and premature stop at codon 84 
C*08:173N Point
Exon 2, 250-252TGG>TGA, causes X60, a premature stop in codon 60 
C*08:180N Deletion
Exon 2, 352-353delAC, in codon 94, causes a frameshift and premature stop at codon 113 
C*08:181N Deletion
Exon 2, 327delC in codon 85, causes frameshift and premature stop at codon 85 
C*08:208N Point
Exon 3, 424-426, TAC>TAG, causes X118, a premature stop at codon 118. 
C*08:214N Point
Exon 2, 250-253TGG>TAA, causes W60X, a premature stop in codon 60 
C*08:224N Insertion
Exon 3, 507insC in codon 146, causes frameshift and premature stop at codon 152 
C*12:39N Point
Exon 2, 250-252TGG>TGA, causes W60X, a premature stop at codon 60Tissue Antigens (2014) 83:184-189
 
C*12:46N Point
Exon 3, 424-429TAC>TAG, causes Y118X, a premature stop at codon 118Tissue Antigens (2014) 83:184-189
 
C*12:80N Point
Exon 2, 250-252TGG>TAG, causes W60X, a premature stop at codon 60 
C*12:84N Insertion
Exon 2, 202-204insA, in codon 44, causes frame shift and premature stop at codon 74 
C*12:104N Point
Exon 3, 502-504CAG-TAG, causes Q144X, a premature stop at codon 144 
C*12:105N Point
Exon 3, 514-516GAG>TAG, causes E148X, a premature stop at codon 148HLA (2017) 90:171-173
 
C*12:148N Point
Exon 2, 265-267CAG>TAG, causes Q65X, a premature stop at codon 65 
C*12:219N Point
Exon 3, 508A>T, causes K146X, a premature stop at codon 146 
C*12:232N Deletion
Exon 3, 564-567delCGTG, in codons 164-165, causes frameshift and premature stop in codon 188 
C*12:236N Deletion
Exon 3, 573delG in codon167, causes frameshift and premature stop in codon 189  
C*12:270N Deletion
Exon 3, 352-353delAC, in codon 94, causes a frameshift and premature stop at codon 113 
C*12:274:01N Deletion
Exon 2, 208delG, in codon 46, causes a frameshift and premature stop at codon 76. 
C*12:295N Deletion
Exon 4, 746-758delCTCAGGACACCGA, in codons 225-229, causes frameshift and premature stop at codon 268 
C*12:311N Deletion
Exon 2, 267-268delGA, causes frameshift and premature stop at codon 73 
C*12:324N Deletion
Exon 4, 875delA, in codon 268, causes a frameshift and premature stop in codon 268  
C*12:327N Point
Exon 3, 619621GAA>TAA, causes E183X, a premature stop in codon 183 
C*12:329N Deletion
Exon 2, 208delG, in codon 46, causes a frameshift and premature stop at codon 76. 
C*12:330N Deletion
Exon 5, 977delC, in codon 302, causes a frameshift and premature stop in codon 303 
C*12:343N Deletion
Exon 3, 537delG in codon 155, causes frameshift and premature stop at codon 189 
C*12:345N Point
Exon 2, 469-471TGG>TAG, causes X133, a premature stop at codon 133 
C*14:07N Point
Exon 3, 583-585TAC-TAA, causes Y171X, a premature stop at codon 171 
C*14:21N Point
Exon 3, 424-426TAC>TAA, causes Y118X, a premature stop at codon 118HLA (2017) 90:171-173
 
C*14:35N Point
Exon 3 361-363TGG>TGA, causes W97X, a premature stop at codon 97 
C*14:47:01N Point
Exon 3, 469-471TGG>TGA, causes W133X, a premature stop at codon 133 
C*14:47:02N Point
Exon 3, 469-471TGG>TAG, causes W133X, a premature stop at codon 133 
C*14:93N Point
Exon 3, 502-504CAG>TAG, causes Q144X, a premature stop in codon 144HLA (2018) 92:107-108
HLA (2018) 92:107-108
 
C*14:97N Point
Exon 2, 250-252TGG>TGA, causes X60, a premature stop in codon 60 
C*14:99N Insertion
Exon 4, 246-249insCGGA, in codon 58, causes frameshift and premature stop in codon 76 
C*14:117N Point
Exon 4, 889-891, AGA>TGA, causes X273, a premature stop at codon 273 
C*15:02:01:08N Point
Intron 2, g431A>T, causes an incorrect splicing leading to the deletion of part of exon 3HLA (2018) 91:187-194
 
C*15:92N Point
Exon 3, 358-360CAG>TAG, causes Q96X, a premature stop codon at 96 
C*15:95N Point
Exon 2, 265-267CAG>TAG, causes Q65X, a premature stop codon in 65HLA (2016) 87:31-35
 
C*15:115N Point
Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54 
C*15:122N Point
Exon 2, 493-495CAG>TAG, causes Q141X, a premature stop at codon 141HLA (2018) 92:304-309
 
C*15:145N Point
Exon 3, 589G>T, causes E173X, premature stop at codon 173 
C*15:156N Deletion
Exon 2, 265-266delCA, in codon 65, causes frameshift and premature stop in codon 73 
C*15:160N Point
Exon 2, 802-804TGG>TGA, causes X244, a premature stop in codon 244HLA (2020) 96:227-229
 
C*15:164N Point
Exon 4, 682-684TGG>TGA, causes X204, a premature stop in codon 204 
C*15:177N Deletion
Exon 3, 426delC, in codon 118, causes a frameshift and premature stop at codon 118. 
C*15:185N Deletion
Exon 3, 590-596delAGAACGG, in codons 173-175, causes frameshift and premature stop in codon 187 
C*15:188N Deletion
Exon 2, 261delG, in codon 63, causes a frameshift and premature stop at codon 76 
C*15:189N Insertion
Exon 2, 240-253insGCCGGAGTATTGGG, in codon 61, causes a frameshift and premature stop at codon 81 
C*15:213N Deletion
Exon 4, 736delG, in codon 222, causes frameshift and premature stop at codon 272 
C*15:216N Point
Exon 2, 244-246GAG>TAG, causes E58X, a premature stop in codon 58. 
C*15:238N Insertion
Exon 3, 384insG, in codon 105, causes a frameshift and premature stop in codon 114 
C*16:30N Point
Exon 2, 331-333CAG>TAG, causes Q87X, a premature stop at 87Tissue Antigens (2014) 83:184-189
 
C*16:77N Point
Exon 2, 325-327TAC>TAA, causes Y85X, a premature stop at codon 85HLA (2017) 90:79-87
 
C*16:89N Point
Exon 2, 244-246GAG>TAG, causes E58X, a premature stop at codon 58 
C*16:123N Point
Exon 2, 271-273TAC>TAG, causes X67, a premature stop in codon 67HLA (2019) 93:505-506
 
C*16:132N Point
Exon 3, 361-363TGG>TGA, causes X97, a premature stop in codon 97 
C*16:186N Insertion
Exon 4, 842insGATA, in codon 257, causes a frameshift and premature stop in codon 257 
C*17:27N Point
Exon 2, 295-297CGA>TGA, causes R75X, a premature stop at codon 75HLA (2016) 87:31-35
 
C*18:07N Point
Exon 3, 415-417CAG>TAG, causes Q115X, a premature stop at codon 115 
E*01:08:01N Point
Exon 2, 313-315TAC>TAG, causes Y84X, a premature stop at codon 84HLA (2017) 89:143-149
 
E*01:08:02N Point
Exon 2, 313-315TAC>TAG, causes Y84X, a premature stop at codon 84HLA (2021) 97:389-398
 
E*01:21:01N Point
Exon 3, 349-351CAG>TAG, causes X96, a premature stop at codon 96HLA (2021) 97:389-398
 
E*01:25N Point
Exon 1, 316-318TAC>TAG, causes X85, a premature stop at codon 85HLA (2021) 97:389-398
 
E*01:55N Point
Exon 3, 364-366, TGC>TGA, causes X101, a premature stop at codon 101HLA (2021) 97:389-398
 
E*01:91N Point
Exon 3, 400-402, TAT>TAA causes X113, a premature stop at codon 113HLA (2021) 97:389-398
 
E*01:117N Point
Exon 3, 349-351CAG>TAG, causes X96, a premature stop at codon 96HLA (2021) 97:389-398
 
G*01:05N Deletion
Exon 3, 460delC, in codon 130, causes frameshift and premature stop at codon 189Immunogenetics (1997) 45:464-5
Immunogenetics (2006) 58:241-51
 
G*01:13N Point
Exon 2, 232-234CAG>TAG, causes Q54X, a premature stop at codon 54Tissue Antigens (2008) 72:491-505
 
G*01:21N Point
Exon 3, 748C>T, causes Q226X, premature stop at codon 226HLA (2018) 91:146-147
 
G*01:25N Deletion
Exon 3, 443-4delTC in codon 124, causes frameshift and premature stop at codon 147. 
G*01:28N Point
Exon 3 409-411TAT>TAA, causes Y113X, a premature stop in codon 113 
DRB1*01:33N Deletion
Exon 2, 123delG, causes frameshift and premature stop codon at 50Tissue Antigens (2011) 78:463-464
 
DRB1*01:39N Point
Exon 2, 112-114TGG>TGA, causes W9X, a premature stop at codon 9Tissue Antigens (2014) 84:497-502
 
DRB1*01:40N Point
Exon 2, 112-114TGG>TGA, causes W9X, a premature stop at codon 9 
DRB1*01:52N Point
Exon 2, 336-338TAC>TAG, causes Y83X, a premature stop at codon 83 
DRB1*01:62:01N Point
Exon 2, 268-270TGG>TGA, causes W61X, a premature stop at codon 61 
DRB1*01:62:02N Point
Exon 2, 268-270TGG>TAG, causes W61X, a premature stop at codon 61 
DRB1*01:68N Point
Exon 2, 295-297CAG>TAG, causes Q70X, a premature stop at codon 70 
DRB1*03:67N Point
Exon 2, 268-270TGG>TGA, causes W61X, a premature stop at codon 61Tissue Antigens (2014) 84:497-502
 
DRB1*03:68N Point
Exon 2, 367-369CGA>TGA, causes R94X, a premature stop at codon 94 
DRB1*03:156N Deletion
Exon 2, 258-273delTGCCGAGTACTGGAAC, in codons 57-62, causes a premature stop at codon 94 
DRB1*03:174N Insertion
Exon 2, 308insC, in codon 74, causes a frameshift and premature stop in codon 98 
DRB1*03:189N Point
Exon 2, 262-264GAG>TAG, causes E59X, a premature stop in codon 59 
DRB1*04:81N Deletion
Exon 2, 296-297delAG, in codon 70, causes frameshift and premature stop at codon 86 
DRB1*04:94:01N Point
Exon 2, 319-321TAC>TAA, causes Y78X, a premature stop at codon 78Tissue Antigens (2011) 78:226-227
 
DRB1*04:119N Point
Exon 2, 334-336TAC>TAG, causes Y83X, a premature stop at codon 83Tissue Antigens (2014) 84:497-502
 
DRB1*04:120N Point
Exon 2, 319-332TAC>TAA, causes Y78X, a premature stop at codon 78Tissue Antigens (2014) 84:497-502
 
DRB1*04:142N Point
Exon 2, 334-336TAC>TAA, causes Y83X, a premature stop at codon 83Tissue Antigens (2014) 84:497-502
 
DRB1*04:157N Point
Exon 2, 319-321TAC>TAA, causes Y78X, a premature stop at codon 78 
DRB1*04:158N Insertion
Exon 2, 304-305insG, in codon 73, causes a frame shift and premature stop codon at codon 87 
DRB1*04:178N Insertion
Exon 2, 318-319insC, in codon 87, causes frame shift and premature stop at codon at 87 Tissue Antigens (2015) 85:78-79
 
DRB1*04:186N Point
Exon 2, 319-321TAC>TAA, causes Y78X, a premature stop at codon 78  
DRB1*04:212N Point
Exon 2, 319-321TAC>TAA, causes Y78X, a premature stop at codon 78 
DRB1*04:214N Point
Exon 2, 187-189CAA>TAA, causes Q34X, a premature stop at codon 34 
DRB1*04:247N Point
Exon 2, 268-270TGG>TGA, causes X61, a premature stop in codon 61 
DRB1*04:264N Point
Exon 2, 169-171GAC>TAA, causes X28, a premature stop in codon 28 
DRB1*04:266N Deletion
Exon 3, 498delA, in codon 137, causes a frameshift and premature stop at codon 147 
DRB1*04:267N Insertion
Exon 2, 305insG, in codon 73, causes a frameshift and premature stop at codon 98 
DRB1*04:280N Point
Exon 2, 181-183TAT>TAA, causes Y32X, a premature stop in codon 35 
DRB1*04:286N Point
Exon 3, 406-408CAG>TAG, causes Q107X, a premature stop in codon 107 
DRB1*04:299N Insertion
Exon 2, 288insC, in codon 68, causes frameshift and premature stop at codon 98 
DRB1*04:300N Deletion
Exon 3, 489delC, in codon 134, causes frameshift and premature stop at codon 147 
DRB1*04:312N Point
Exon 2, 127-129GAG>TAG, causes E14X, a premature stop in codon 14 
DRB1*04:329N Point
Exon 2, 277-279CAG>TAG, causes Q64X, a premature stop in codon 64 
DRB1*07:10N Deletion
Exon 2, 175-176delTG, in codon 30, causes frameshift and premature stop at codon 32Immunogenetics (2007) 59:507-10
 
DRB1*07:26N Insertion
Exon 2, 172-173insA, in codon 29, causes a frame shift and a premature stop at codon 33 
DRB1*07:58N Point
Exon 2, 160-162CAG>TAG, causes R25X, a premature stop at codon 25 
DRB1*07:68N Deletion
Exon 2, 278delA, in codon 64, causes frameshift and premature stop at codon 99 
DRB1*07:87N Point
Exon 2, 367-369CGA>TGA, causes X94, a premature stop in codon 94 
DRB1*07:101N Deletion
Exon 3, 262delC in codon 59, causes frameshift and premature stop at codon 99 
DRB1*07:118N Point
Exon 2, 115-117, CAG>TAG, causes X10, a premature stop at codon 10 
DRB1*07:129N Point
Exon 2, 187CAG>TAG, causes Q34X, a premature stop in codon 34 
DRB1*08:60N Deletion
Exon 2, 341delT, in codon 85, causes frameshift and premature stop at codon 99  
DRB1*08:78N Point
Exon 2, 277-279CAG>TAG, causes Q64X, a premature stop at codon 64 
DRB1*08:89N Deletion
Exon 2, 157delG, in codon 24, causes a frameshift and premature stop at codon 50 
DRB1*09:37N Deletion
Exon 2, 128-131delAGTG, in codons 14-15, causes a frameshift and premature stop at codon 50 
DRB1*11:169N Deletion
Exon 2, 326-327delGA, in codon 80, causes frameshift and premature stop at codon 86 
DRB1*11:217N Point
Exon 2, 194G>T, causes E36X, premature stop at codon 36 
DRB1*11:246N Insertion
Exon 2, 175insA, in codon 30, causes a frameshift and a premature stop at codon 33. 
DRB1*11:250N Insertion
Exon 3, 585-607insGAGTGGAGAGGTTTACACCTGCC, in codon 174, causes a frameshift and premature stop at codon 188 
DRB1*11:287N Point
Exon 2, 268-270TGG>TGA, causes X61, a premature stop at codon 61 
DRB1*11:294N Deletion
Exon 2, 256delGATG in codon 57, causes a frameshift and premature stop in codon 98 
DRB1*12:24N Point
Exon 2, 268-270TGG>TAG, causes Y61X, a premature stop at codon 61Tissue Antigens (2011) 78:45-48
 
DRB1*12:31N Point
Exon 2, 127-129GAA>TAG, causes E14X, a premature stop at codon 14HLA (2017) 90:171-173
 
DRB1*12:60N Deletion
Exon 2, 157-157delG, in codon 24, causes frameshift and premature stop at codon 50HLA (2017) 89:65-66
 
DRB1*12:72N Deletion
Exon 3, 409-424delCCCCTGCAGCACCACA, in codons 108-113, causes a frameshift and premature stop at codon 114 
DRB1*12:74N Deletion
Exon 2, 254delC, in codon 56, causes a frameshift and premature stop at codon 99 
DRB1*12:86N Point
Exon 3, 415-417CAG>TAG, causes X110, a premature stop at codon 110 
DRB1*13:113N Deletion
Exon 2, 246delG, causes frameshift and premature stop at codon 99HLA (2017) 90:171-173
 
DRB1*13:137N Point
Exon 2, 298-300AGG>TAG, causes R71X, a premature stop at codon 71Tissue Antigens (2014) 84:497-502
 
DRB1*13:142N Point
Exon 2, 277-279CAG>TAG, causes Q64X, a premature stop at codon 64Tissue Antigens (2014) 84:497-502
 
DRB1*13:185N Point
Exon 2, 223-225GAG>TAG, causes E46X, a premature stop at codon 46 
DRB1*13:200N Point
Exon 2, 112-114GAG>TAG, causes W9X, a premature stop at codon 9 
DRB1*13:249N Deletion
Exon 2, 270delG, in codon 61, causes frameshift and premature stop at codon 61 
DRB1*13:252N Point
Exon 2, 367-369CGA>TGA, causes X94, a premature stop in codon 94 
DRB1*13:255N Point
Exon 3, 478-480TGG>TAG, causes X131, a premature stop in codon 131 
DRB1*13:268N Deletion
Exon 3, 610delG, in codon 175, causes a frameshift and premature stop at codon 180 
DRB1*13:289N Insertion
Exon 2, 269insTACT, in codon 61, causes a frameshift and premature stop in codon 88. 
DRB1*13:295N Insertion
Exon 2, 304insG in codon 73, causes frameshift and premature stop at codon 87 
DRB1*13:298N Deletion
Exon 3, 415-416delCA, in codon 110, causes frameshift and premature stop at codon 127 
DRB1*13:310N Point
Exon 2, 367-369CGA>TGA, casuses X94, a premature stop at codon 94 
DRB1*13:319N Deletion
Exon 3, 501delAA, in codon 139, causes a frameshift and premature stop at codon 192 
DRB1*14:92N Point
Exon 2, 190-192GAG>TAG, causes E35X, a premature stop at codon 35 
DRB1*14:137N Insertion
Exon 2, 304-305insG, in codon 73, causes frame shift and premature stop at codon 98Tissue Antigens (2013) 82:201-202
 
DRB1*14:152N Insertion
Exon 2, 303-304insG, in codon 73, causes a frame shift and a premature stop at codon 98 
DRB1*14:166N Point
Exon 2, 173-174insA, in codon 29, causes frameshift and premature stop at codon 33HLA (2016) 87:60-60
 
DRB1*14:188N Point
Exon 2, 113C>T, causes Q16X, premature stop at codon 116 
DRB1*14:195N Point
Exon 2, 265-267TAC>TAG, causes X60, a premature stop in codon 60 
DRB1*14:197N Point
Exon 2, 307-309GAG>TAG, causes X74, a premature stop in codon 74 
DRB1*14:222N Point
Exon 2, 262-264, GAG>TAG, causes E59X, a premature stop in codon 59. 
DRB1*14:231N Deletion
Exon 2, 118-123delTCTAC in codon 11-12, causes frameshift and premature stop at codon 12 
DRB1*15:17N Insertion
Exon 2, 294-295insGA, in codon70, causes frameshift and premature stop at codon 100Tissue Antigens (2005) 66:334-5
 
DRB1*15:50N Deletion
Exon 2, 303-304delGG, causes frameshift and premature stop at codon 97 
DRB1*15:80N Deletion
Exon 2, 303-304delGG, in codon 71, causes frameshift and premature stop at codon 86 
DRB1*15:113N Point
Exon 2, 115-117CAG>TAG, causes Q10X, a premature stop at codon 10 
DRB1*15:115N Deletion
Exon 2, 295-296delGA, in codon 70, causes frameshift and premature stop at codon 86Tissue Antigens (2015) 86:69-70
 
DRB1*15:129N Deletion
Exon 2, 303-304delGG, in codons 72-73, causes frameshift and premature stop at codon 97 
DRB1*15:134N Deletion
Exon 2, 142-143delTG, in codon 19, causes frameshift and premature stop at codon 32 
DRB1*15:137N Point
Exon 2, 187-189CAG>TAG, causes Q34X, a premature stop at codon 34 
DRB1*15:138N Insertion
Exon 2, 158-158insG, in codon 24, causes frameshift and premature stop at codon 33 
DRB1*15:148N Deletion
Exon 2, 187delC in codon 34, causes frameshift and premature stop in codon 50HLA (2018) 91:544-545
 
DRB1*15:154N Point
Exon 3, 615-617GAG>TAG, causes X176, a premature stop in codon 176 
DRB1*15:159N Point
Exon 2, 367-369CGA>TGA, causes X94, a premature stop in codon 94 
DRB1*15:163N Deletion
Exon 3, 406delC, in codon 107, causes a frameshift and premature stop in codon 119 
DRB1*15:176N Insertion
Exon 2, 259insGC, in codon 58, causes a frameshift and premature stop in codon 100HLA (2019) 94:462-463
 
DRB1*15:180N Point
Exon 3, 373-375, CAA>TAA, causes X96, a premature stop at codon 96 
DRB1*15:183N Deletion
Exon 2, 224delA in codon 46, causes frameshift and premature stop at codon 50 
DRB1*16:13N Point
Exon 2, 241-243GAG>TAG, causes E52X, a premature stop at codon 52Tissue Antigens (2008) 71:180-2
 
DRB1*16:21N Deletion
Exon 2, 170-171delAA, in codon 28, causes frameshift and premature stop at codon 32 
DRB1*16:41N Point
Exon 2, 334-336TAC>TAA, causes Y83X, a premature stop at codon 83 
DRB1*16:55N Insertion
Exon 2, 303-304insGG, in codon 73, causes a frameshift and premature stop in codon 100 
DRB1*16:62N Insertion
Exon 2, 134insA, in codon 16, causes frameshift and premature stop at codon 33 
DRB1*16:63N Deletion
Exon 2, 216delC, in codon 43, causes a frameshift and premature stop at codon 50 
DRB1*16:70N Insertion
Exon 2, 305insGG, in codon 73, causes a frameshift and premature stop at codon 100 
DRB3*01:26N Point
Exon 2, 175-177TAC>TAA, causes C30X, a premature stop at codon 30 
DRB3*01:40:01N Point
Exon 2, 334-336TAC>TAA, causes Y83X, a premature stop at codon 83 
DRB3*01:40:02N Point
Exon 2, 334-336TAC>TAG, causes X83, a premature stop in codon 83 
DRB3*01:73N Insertion
Exon 2, 224insG in codon 46, causes frameshift and premature stop at codon 87 
DRB3*01:77N Point
Exon 2, 367-369CGA>TGA, causes R94X, a premature stop at codon 94. 
DRB3*01:81N Deletion
Exon 2, 207delC, in codon 40, causes frameshift and premature stop at codon 50 
DRB3*01:97N Deletion
Exon 2, 222delG, in codon 46, causes a frameshift and premature stop in codon 50. 
DRB3*02:29N Deletion
Exon 3, 588-592delTGGAG, in codons 167-169, causes frameshift and premature stop at codon 191 
DRB3*02:55N Point
Exon 2, 334-336TAC>TAG, causes Y83X, a premature stop at codon 83 
DRB3*02:67N Point
Exon 2, 277C>T, causes Q64X, a premature stop at codon 64 
DRB3*02:80N Point
Exon 2, 268-270TGG>TGA, causes X61, a premature stop in codon 61 
DRB3*02:95N Deletion
Exon 2, 225delG, in codon 46, causes a frameshift and premature stop in codon 50 
DRB3*02:109N Point
Exon 2, 307-307CAG>TAG, causes Q34X, a premature stop in codon 74 
DRB3*02:121N Insertion
Exon 2, 260-263insCCGA, in codon 59, causes frameshift and premature stop at codon 88 
DRB3*02:125N Insertion
Exon 2, 258insT, in codon 58, causes frameshift and premature stop at codon 87 
DRB3*02:137N Insertion
Exon 2, 304insG, in codon 73, causes frameshift and premature stop at codon 87 
DRB3*02:145N Point
Exon 3, 607-609CAA>TAA, causes Q174X, a premature stop at codon 174 
DRB3*02:165N Point
Exon 3, 478-480TGG>TGA, causes X131, a premature stop at codon 131 
DRB3*03:30N Deletion
Exon 2, 231delG in codon 46, causes X50, frameshift and premature stop at codon 50 
DRB4*01:03:01:02N Point
Incorrect splicing results in lack of protein sequenceImmunogenetics (1990) 31:112-7
Immunogenetics (1990) 31:112-7
Tissue Antigens (1997) 49:152-9
 
DRB4*01:03:01:13N Point
Intron 1, g9656G>A, causes a mutation in the splice site prior to exon 2, which may affect expression 
DRB4*01:14N Point
Intron 1, g9656G>A, causes incorrect splicing which results in lack of protein sequenceHLA (2020) 95:73-75
 
DRB4*01:16N Point
Exon 2, 265-267TAC>TAG, causes Y60X, a premature stop at codon 60 
DRB4*01:38N Point
Exon 2, 361-363CAG>TAG causes Q92X, a premature stop at codon 92 
DRB4*01:54:01N Point
Exon 2, 367C>T, causes R94X, premature stop at codon 94 
DRB4*01:54:02N Point
Exon 2, 367369CGA>TGA, causes R94X, a premature stop in codon 94 
DRB4*01:56N Point
Exon 2, 277C>T, causes Q64X, premature stop at codon 64 
DRB4*01:57N Point
Exon 2, 183T>G, causes Y32X, a premature stop at codon 32 
DRB4*01:61N Point
Exon 2, 330C>G, causes Y80X, a premature stop at codon 80 
DRB4*01:65N Point
Exon 2, 154-156CGA>TGA, causes R23X, a premature stop in codon 23 
DRB4*01:71N Point
Exon 2, 334-336TAC>TAG, causes X83, a premature stop in codon 83 
DRB4*01:80N Insertion
Exon 2, 291insT, in codon 68, causes a frameshift and premature stop in codon 98 
DRB4*01:84N Deletion
Exon 2, 267delC, in codon 60, causes a frameshift and premature stop in codon 99 
DRB4*01:108N Deletion
Exon 2, 212delG, in codon 42, causes frameshift and premature stop at codon 50 
DRB4*01:113N Deletion
Exon 2, 139delC, in codon 18, causes frameshift and premature stop at codon 27 
DRB4*01:115N Deletion
Exon 1, 125-128delTTGA, in codons 13-14, causes frameshift and premature stop at codon 26 
DRB4*01:121N Point
Exon 1, 115-117, CAG>TAG, causes X10, a premature stop at codon 10 
DRB4*01:128N Point
Exon 3, 391-393TAT>TAA, causes Y102X, a premature stop in codon 102 
DRB4*01:145N Deletion
Exon 3, 395delC in codon 103, causes frameshift and premature stop at codon 119 
DRB4*01:149N Point
Exon 2, 229-231CAG>TAG, causes R48X, a premature stop in codon 48. 
DRB4*02:01N Deletion
Exon 2, 155-165delGGGTGCGGTTG, in codons 23-26, causes frameshift and premature stop at codon 29Immunogenetics (1997) 46:104-10
 
DRB4*03:01N Deletion
The allele contains sequence for intron 2 and exon 3, but has no preceding exon sequencesImmunogenetics (1997) 46:104-10
Human Immunology (2018) 79:491-493
 
DRB5*01:08:01N Deletion
Exon 3, 572-590delAAACAGTTCCTCGGAGTGG, in codons 162-168, causes frameshift and possible stop codon after 171Tissue Antigens (1997) 50:326-33
Human Immunology (2019) 80:4437-448
 
DRB5*01:08:02N Deletion
Exon 3, 573-591delAACAGTTCCTCGGAGTGGA in codons 162-168, causes frameshift and premature stop at codon 174 
DRB5*01:10N Deletion
Exon 2, 326- 327delGA, in codon 80, causes frameshift and premature stop at codon 86Tissue Antigens (2000) 55:467-9
 
DRB5*01:27N Point
Exon 2, 336C>G, causes Y83X, a premature stop at codon 83 
DRB5*01:48N Point
Exon 2, 265-267TAC>TAG, causes X60, a premature stop at codon 60 
DRB5*01:49N Point
Exon 3, 553-555CAG>TAG, causes X156, a premature stop at codon 156. 
DRB5*01:52N Deletion
Exon 2, 189-190delAG, in codons 34-35, causes a frameshift and premature stop at codon 56 
DRB5*01:53N Insertion
Exon 2, 247-248insTG, in codon 54, causes a frameshift and premature stop at codon 100 
DRB5*01:58N Insertion
Exon 2, 303-304insGG, in codon 72, causes a frameshift and premature stop in codon 100 
DRB5*01:67N Insertion
Exon 2, 288insT in codon 67, causes frameshift and premature stop at codon 8 
DRB5*01:68N Point
Exon 2, 124-126TAT>TAA, causes Y13X, a premature stop at codon 13 
DRB5*01:71N Insertion
Exon 2, 290insG, in codon 68, causes frameshift and premature stop at codon 87 
DRB5*01:81N Insertion
Exon 2, 318insC, in codon 78, causes a frameshift and premature stop at codon 87 
DRB5*01:83N Insertion
Exon 2, 224insA, in codon 46, causes frameshift and premature stop at codon 57 
DRB5*01:92N Point
Exon 2, 321-323TAC>TAG, causes Y78X, a premature stop in codon 78 
DRB5*01:101N Insertion
Exon 2, 108insT in codon 7, causes frameshift and premature stop at codon 12 
DRB5*02:19N Point
Exon 2, 319-321TAC>TAA, causes X78, a premature stop in codon 78 
DRB5*02:25N Deletion
Exon 2, 303-304delGG, in codons 72-73, causes frameshift and premature stop in codon 95 
DRB5*02:26N Deletion
Exon 3, 573-591delAACAGTTCCTCGGAGTGGA, in codons 162-168, causes frameshift and premature stop in codon 174 
DQA1*01:15N Point
Exon 2, 212G>A, causes W48X, a premature stop at codon 48HLA (2017) 90:130-131
 
DQA1*01:16N Deletion
Exon 2, 236delG, in codon 56, causes frameshift and premature stop at codon 63 
DQA1*02:02N Insertion
Exon 2, 329-330insGA, in codon 87, causes frameshift and premature stop in codon 100 
DQA1*03:27N Deletion
Exon 2, 179-193delTGGACCTGGAGAGG in codons 37-41, causes a frameshift and premature stop at codon 50 
DQA1*04:03N Point
Exon 2, 236-238AAA>TAA, causes Q53X, a premature stop at codon 53Tissue Antigens (2004) 63:609-11
 
DQA1*05:15N Deletion
Exon 2, 203-206delTCTG, in codons 45-46, causes a frameshift and premature stop in codon 61 
DQA1*05:17N Point
Exon 3, 580-521TGG>TGA, causes W171X, a premature stop at codon 171 
DQA1*05:36N Point
Exon 2, 166-169GAG>TAG, in codon 33 causes E33X, a premature stop in codon 33 
DQB1*02:18N Point
Exon 2, 277-279TGG>TGA, causes W61X, a premature stop at codon 61Tissue Antigens (2014) 84:497-502
 
DQB1*02:20N Point
Exon 2, 376-378CGA>TGA, causes R94X, a premature stop at codon 94Tissue Antigens (2014) 84:497-502
 
DQB1*02:58N Point
Exon 2, 199-201GAA>TAA, causes E35X, a premature stop at codon 35 
DQB1*02:67N Point
Exon 2, 142-144TAC>TAG, causes Y16X, a premature stop at codon 16 
DQB1*02:96N Point
Exon 3, 449C>A, causes S118X, premature stop at codon 118 
DQB1*02:129N Deletion
Exon 2, 126delG, in codon 10, causes a frameshift and premature stop at codon 27 
DQB1*02:132N Deletion
Exon 2, 247delA, in codon 51, causes a frameshift and premature stop at codon 99 
DQB1*02:134N Deletion
Exon 2, 320delT, in codon 75, causes a frameshift and premature stop at codon 99 
DQB1*02:162N Point
Exon 2, 274-276TAC>TAG, causes Y60X, a premature stop in codon 60HLA (2021) 98:244-246
 
DQB1*02:163N Point
Exon 1, 67-69, TCG>TAG, causes X-10, a premature stop at codon -10 
DQB1*02:167N Insertion
Exon 2, 184-187insAGCA, in codon 31, causes frameshift and premature stop at codon 34 
DQB1*02:176N Insertion
Exon 3, 535insC, in codon 147, causes a frameshift and premature stop in codon 149 
DQB1*02:177N Point
Exon 2, 367-369TTG>TAG, causes L91X, a premature stop in codon 91 
DQB1*02:183N Deletion
Exon 2, 279delG in codon 61, causes frameshift and premature stop at codon 61. 
DQB1*02:194N Point
Exon 2, 139>141TGC>TGA, causes C15X, a premature stop at codon 15 
DQB1*03:66N Point
Exon 2, 277-279TGG>TAG, causes W61X, a premature stop at codon 61Tissue Antigens (2014) 84:497-502
 
DQB1*03:84N Point
Exon 2, 622-624GAG>TAG, causes E176X, a premature stop at codon 176 
DQB1*03:90N Deletion
Exon 2, 240delG, in codon 48, causes a premature stop codon at 50HLA (2017) 90:171-173
 
DQB1*03:95N Deletion
Exon 2, 183delG, in codon 29, causes a premature stop codon at 50HLA (2017) 90:171-173
 
DQB1*03:118N Point
Exon 2, 205-207TAC>TAA, causes Y37X, a premature stop at codon 37 
DQB1*03:213N Point
Exon 2, 286-288CAG>TAG, causes Q64X, a premature stop at codon 64 
DQB1*03:237N Point
Exon 2, 205-207TAC>TAA causes Y37X, a premature stop at codon 37 
DQB1*03:269N Point
Exon 2, 196C>T, causes R34X, premature stop at codon 34HLA (2019) 95:128-130
 
DQB1*03:276N Deletion
The allele contains sequence from intron 1 onwards, but has no preceding exon sequencesHuman Immunology (2018) 79:491-493
 
DQB1*03:282N Deletion
Exon 2, 258delG, in codon 54, causes frameshift and premature stop in codon 99HLA (2021) 98:408-410
 
DQB1*03:303N Point
Exon 2, 301-303GAG>TAG, causes X69, a premature stop at codon 69 
DQB1*03:310N Deletion
Exon 3, 525-531delGTCCACC, in codons 143-145, causes a frameshift and premature stop at codon 157 
DQB1*03:334N Point
Exon 2, 121-123TAC>TAG, causes X9, a premature stop at codon 9 
DQB1*03:338N Deletion
Exon 3, 535delC, in codon 147, causes a frameshift and premature stop at codon 159 
DQB1*03:339N Insertion
Exon 2, 233insG, in codon 46, causes a frameshift and premature stop at codon 135 
DQB1*03:340N Deletion
Exon 3, 566delT, in codon 157, causes a frameshift and premature stop at codon 159 
DQB1*03:354N Deletion
Exon 2, 209-221delCACGCTTCGACAG, in codons 38-42, causes a frameshift and premature stop in codon 46 
DQB1*03:356N Insertion
Exon 2, 222-226insGACAG, in codon 42, causes frameshift and premature stop in codon 52 
DQB1*03:357N Deletion
Exon 2, 220delA, in codon 42, causes a frameshift and premature stop in codon 50 
DQB1*03:358N Deletion
Exon 3, 634-661delCTCCAGAACCCCATCACCGTGGAGTGGC, in codons 180-189, causes a frameshift and premature stop in codon 191 
DQB1*03:375N Point
Exon 3, 4445-447TGC>TGA, causes C117X, a premature stop in codon 117 
DQB1*03:376N Point
Exon 3, 658-660TGG>TAG, causes W188X, a premature stop in codon 188 
DQB1*03:385N Point
Exon 3, 592-594CAG>TAG, causes Q166X, a premature stop in codon 166 
DQB1*03:399N Point
Exon 2, 346-348CAG>TAG, causes Q84X, a premature stop at codon 84 
DQB1*03:400N Insertion
Exon 3, 353insC, in codon 147, causes a frameshift and a premature stop in codon 149HLA (2020) 96:749-750
 
DQB1*03:403N Insertion
Exon 3, 583-589insTTTGTCT, in codon 165, causes frameshift and premature stop at codon 195 
DQB1*03:407N Point
Exon 2, 121-123, TAC>TAG, causes X9, a premature stop at codon 9 
DQB1*03:411N Deletion
Exon 2, 313delG in codon 73, causes frameshift and premature stop at codon 99 
DQB1*03:422N Point
Exon 3, 637-639, CAG>TAG, causes X181, a premature stop at codon 181Human Immunology (2020) 81:202-205
 
DQB1*03:427N Insertion
Exon 2, 236insGT, in codon 47, causes a frameshift and premature stop in codon 51. 
DQB1*03:440N Insertion
Exon 2, 327insT in codon 77, causes frameshift and premature stop at codon 135 
DQB1*04:25N Point
Exon 2, 271-273GAG>TAG, causes E59X, a premature stop at codon 59HLA (2016) 87:31-35
 
DQB1*04:36N Point
Exon 2, 376-378CGA>TGA, causes R94X, a premature stop at codon 94 
DQB1*04:41N Point
Exon 3, 465T>G, causes Y123X, a premature stop at codon 123 
DQB1*04:46N Point
Exon 3, 472-474CAG>TAG, causes X126, a premature stop in codon 126 
DQB1*04:59N Deletion
Exon 3, 592delC, in codon 166, causes a frameshift and premature stop at codon 200 
DQB1*04:68N Insertion
Exon 3, 406insT, in codon 104, causes frameshift and premature stop in codon 135 
DQB1*04:73N Deletion
Exon 2, 247delA, in codon 51, causes a frameshift and premature stop in codon 99HLA (2021) 97:171-172
 
DQB1*05:41N Point
Exon 3, 448-450TCG>TAG, causes S118X, a premature stop at codon 118HLA (2017) 90:171-173
 
DQB1*05:90N Point
Exon 3, 448-450TCG>TAG, causes S118X, a premature stop at codon 118 
DQB1*05:110N Point
Exon 2, 196-198CGA>TGA, causes R34X, a premature stop at codon 34 
DQB1*05:128N Point
Exon 2, 370-372CAG>TAG causes Q92X, a premature stop at codon 92 
DQB1*05:185N Point
Exon 2, 472-474CAG>TAG, causes X126, a premature stop at codon 126  
DQB1*05:206N Deletion
Exon 2, 279delG, in codon 61, causes a frameshift and premature stop in codon 61 
DQB1*05:208N Point
Exon 2, 124-126CAG>TAG, causes Q10X, a premature stop in codon 10 
DQB1*05:215N Deletion
Exon 2, 307delG, in codon 71, causes a frameshift and premature stop in codon 99 
DQB1*05:224N Insertion
Exon 2, 205insT, in codon 37, causes a frameshift and premature stop in codon 57 
DQB1*05:235N Point
Exon 2, 121-123TAC>TAA, causes Y9X, a premature stop in codon 9HLA (2021) 97:254-255
 
DQB1*05:236N Point
Exon 2, 196-199CGA>TGA, causes R34X, a premature stop in codon 34HLA (2020) 96:373-375
 
DQB1*05:265N Deletion
Exon 3, 529delA in codon 145, causes frameshift and premature stop at codon 159 
DQB1*05:273N Deletion
Exon 2, 192delT, in codon 32, causes a frameshift and premature stop at codon 32 
DQB1*05:283N Deletion
Exon 4, 730delT in codon 212, causes a frameshift and loss of stop codon in exon 8, resulting in the peptide containing an additional 3 amino acids 
DQB1*06:26N Point
Exon 2, 181-183AGA>TGA, causes R29X, a premature stop at codon 29 
DQB1*06:54N Point
Exon 2, 277-279TGG>TGA, causes W61X, a premature stop at codon 61Tissue Antigens (2014) 84:497-502
 
DQB1*06:75N Point
Exon 2, 274-276TAC>TAG, causes Y60X, a premature stop at codon 60Tissue Antigens (2014) 84:497-502
 
DQB1*06:77N Point
Exon 2, 253-255CAG>TAG, causes Q53X, a premature stop at codon 53 
DQB1*06:102N Point
Exon 3, 487-489TGG>TAG, causes W131X, a premature stop at codon 131HLA (2017) 90:171-173
 
DQB1*06:112N Point
Exon 2, 124-126CAG>TAG, causes Q10X, a premature stop at codon 10HLA (2017) 90:171-173
 
DQB1*06:144N Point
Exon 2, 205-207TAC>TAA, causes Y37X, a premature stop at codon 37 
DQB1*06:158N Point
Exon 2, 196-198CGA>TGA causes R34X, a premature stop at codon 34 
DQB1*06:179N Point
Exon 2, 196-198CGA>TGA, causes R34X, a premature stop at codon 34 
DQB1*06:193N Point
Exon 2, 277-279TGG>TAG, causes Y61X, a premature stop at codon 61 
DQB1*06:216N Point
Exon 2, 655G>T, causes E187X, a premature stop at codon 187 
DQB1*06:252N Deletion
Exon 2, 139delT, in codon 15, causes frameshift and premature stop in codon 27 
DQB1*06:303N Deletion
Exon 2, 265-271delGTTGCCG, in codon 57, causes frameshift and premature stop at codon 97 
DQB1*06:304N Deletion
Exon 3, 535delC, in codon 147, causes frameshift and premature stop at codon 159 
DQB1*06:306N Insertion
Exon 2, 313insG, in codon 73, causes framshift and premature stop at codon 135 
DQB1*06:308N Deletion
Exon 3, 593delC, in codon 166, causes frameshift and premature stop at codon 200 
DQB1*06:317N Point
Exon 4, 682C>T, causes X196, a premature stop at codon 196 
DQB1*06:330N Deletion
Exon 3, 555delG, in codon 153, causes frameshift and premature stop in codon 153 
DQB1*06:341N Point
Exon 2, 343-345TAC>TAG, causes Y83X, a premature stop in codon 83 
DQB1*06:345N Point
Exon 2, 196-198CGA>TGA, causes R34X, a premature stop at codon 34 
DQB1*06:379N Deletion
Exon 2, 129delT, in codon 11, causes a frameshift and premature stop in codon 27 () :-
 
DQB1*06:383N Deletion
Exon 2, 167-171delTGCGT in codon 24-25, causes a frameshift and premature stop at codon 31 
DQB1*06:394N Point
Exon 3, 553-555TGG>TAA, causes X153, a premature stop at codon 153 
DQB1*06:397N Point
Exon 3, 657-659TGG>TAG, causes X188, a premature stop at codon 188 
DQB1*06:414N Deletion
Exon 3, 516delC, in codon 140, causes a frameshift and premature stop at codon 159 
DPA1*01:29N Point
Exon 3, 454-456, TGG>TAG, causes X121, a premature stop at codon 121HLA (2020) 95:82-83
 
DPA1*01:32N Point
Exon 2, 154-156GAG>TAG, causes E21X, a premature stop in codon 21 
DPA1*01:35N Point
Exon 2, 316-318,CAG>TAG, causes X75, a premature stop at codon 75HLA (2020) 96:378-379
 
DPA1*01:55N Deletion
Exon 3, 586delG in codon 165, causes frameshift and premature stop at codon 203 
DPA1*01:66N Deletion
Exon 2, 302delT in codon 70, causes frameshift and premature stop at codon 70 
DPA1*01:79N Insertion
Exon 2, 326insA in codon 78, causes frameshift and premature stop at codon 88 
DPA1*02:13N Point
Exon 4, 628-630GAG>TAG, causes X179, a premature stop at codon 179 
DPA1*02:32N Deletion
Exon 3, 369delT in codon 92, causes frameshift and premature stop at codon 151.Human Immunology (2020) 81:202-205
 
DPA1*02:41N Point
Exon 3, 628-670GAG>TAG, in codon 179, causes E179X, a premature stop in codon 179 
DPA1*02:52N Point
Exon 2, 220-222TGG>TGA, causes W43X, a premature stop in codon 43 
DPB1*04:01:01:24N Point
Intron 2, g5163G>T, affecting splicing site for exon 2 
DPB1*61:01N Point
Exon 2, 286-288GAG>TAG, causes E67X, a premature stop at codon 67Tissue Antigens (1996) 47:293-9
 
DPB1*64:01N Point
Exon 2, 106-108TAC>TAA, causes Y7X, a premature stop at codon 7Tissue Antigens (1997) 49:262-6
HLA (2018) 92:426-427
 
DPB1*120:01N Point
Exon 2, 115-118CAG>TAG, causes Q10X, a premature stop at codon 10 
DPB1*154:01N Point
Exon 2, 271-273CAG>TAG, causes Q62X, a premature stop at codon 62 
DPB1*159:01N Point
Exon 2, 361-363CGA>TGA, causes R92X, a premature stop at codon 92 
DPB1*161:01N Point
Exon 2, 340-342GAG>TAG, causes E85X, a premature stop at codon 85 
DPB1*216:01N Point
Exon 2, 319-321AGA>TGA, causes R78X, a premature stop at codon 78HLA (2016) 87:31-35
 
DPB1*218:01N Point
Exon 2, 151-153CAG>TAG, causes Q22X, a premature stop at codon 22 
DPB1*328:01N Point
Exon 2, 361-363CGA>TGA, causes R92X, a premature stop at codon 92 
DPB1*357:01N Point
Exon 2, 328-330TAC>TAG, causes Y81X, a premature stop at codon 81HLA (2016) 87:31-35
 
DPB1*382:01N Point
Exon 2, 166-168AGA>TGA, causes R27X, a premature stop at codon 27 
DPB1*401:01:01N Point
Exon 2, 328-330TAC>TAG, causes Y81X, a premature stop at codon 81 
DPB1*401:01:02N Point
Exon 2, 328-330TAG>TAA, causes X81, a premature stop at codon 81. 
DPB1*403:01N Point
Exon 2, 262-264TGG>TGA, causes W59X, a premature stop at codon 59 
DPB1*450:01N Point
Exon 2, 124-126CAG>TAG, causes Q13X, a premature stop at codon 13 
DPB1*455:01N Point
Exon 2, 355-357CAG>TAG, causes Q90X, a premature stop at codon 90 
DPB1*507:01N Point
Exon 2, 340-342GAG>TAG, causes E85X, a premature stop at codon 85 
DPB1*551:01N Point
Exon 2, 262-264TGG>TGA, causes W59X, a premature stop at codon 59 
DPB1*570:01N Point
Exon 2, 115-118CAG>TAG, causes Q10X, a premature stop at codon 10 
DPB1*598:01N Point
Exon 2, 151-153CAG>TAG, causes Q22X, a premature stop at codon 22 
DPB1*657:01N Point
Exon 2, 330TAC>TAA, causes Y81X, a premature stop at codon 81 
DPB1*661:01N Point
Exon 2, 166C>A, causes R27X, a premature stop at codon 27 
DPB1*691:01N Point
Exon 2, 184G>T, causes E33X a premature stop at codon 33 
DPB1*693:01N Deletion
Exon 2, 184delG, in codon 33, causes frameshift and premature stop at codon 48 
DPB1*696:01N Deletion
Exon 2, 132-133delCT, in codons 14-15, causes frameshift and premature stop in codon 15 
DPB1*700:01N Point
Exon 3, 490-492GAG>TAG, causes E135X, a premature stop in codon 135 
DPB1*712:01N Point
Exon 2, 319-321AGA>TGA, causes X78, a premature stop in codon 78 
DPB1*724:01N Point
Exon 3, 469-471CGA>TGA, causes R128X, a premature stop in codon 128 
DPB1*732:01N Point
Exon 2, 469-471CGA>TGA, causes X128, a premature stop in codon 128 
DPB1*738:01N Deletion
Exon 2, 243delG, in codon 52, causes frameshift and premature stop in codon 87 
DPB1*743:01N Point
Exon 2, 262-264TGG>TAG, causes X59, a premature stop in codon 59 
DPB1*748:01N Point
Exon 2, 259-261TAC>TAG, causes X58, a premature stop in codon 58 
DPB1*754:01N Point
Exon 2, 409-411CAG>TAG, causes X108, a premature stop in codon 108 
DPB1*756:01N Point
Exon 2, 469-471CGA>TGA, causes X128, a premature stopn in codon 128 
DPB1*777:01N Point
Exon 2, 487-489CAG>TAG, causes X134, a premature stop at codon 134 
DPB1*786:01:01N Point
Exon 2, 473-474TGG>TAG, causes W129X, a premature stop at X129 
DPB1*786:01:02N Point
Exon 2, 474-476TGG>TAG, causes W129X, a premature stop at codon 129 
DPB1*792:01N Point
Exon 2, 645-647TGG>TAG, causes W186X, a premature stop at 186 
DPB1*794:01N Point
Exon 2, 580-582CAG>TAG, causes X165, a premature stop at 165 
DPB1*800:01N Point
Exon 2, 577-579CAG>TAG, causes Q164X, a premature stop at 164 
DPB1*821:01N Point
Exon 1, 330-332TAC>TAA, causes X81, a premature stop at 81 
DPB1*831:01N Point
Exon 1, 289-291GAG>TAG, causes X68, a premature stop at codon 68 
DPB1*838:01N Point
Exon 1, 171-173TAC>TAG, causes X28, a premature stop at codon 28 
DPB1*844:01N Point
Exon 1, 286-288GAG>TAG, causes X67, a premature stop at codon 67 
DPB1*862:01N Point
Exon 2, 474-476TGG>TGA, causes X129, a premature stop at codon 129 
DPB1*865:01N Deletion
Exon 2, 342delG, in codon 85, causes a frameshift and premature stop in codon 87 
DPB1*866:01N Deletion
Exon 3, 402delG, in codon 105, causes a frameshift and premature stop in codon 117 
DPB1*867:01N Insertion
Exon 2, 196insA, in codon 37, causes a frameshift and premature stop in codon 106 
DPB1*868:01N Deletion
Exon 2, 171delC, in codon 28, causes a frameshift and premature stop in codon 28 
DPB1*869:01N Deletion
Exon 2, 205delA, in codon 40, causes a frameshift and premature stop in codon 48 
DPB1*870:01N Deletion
Exon 2, 171delC, in codon 28, causes a frameshift and premature stop in codon 28 
DPB1*871:01N Insertion
Exon 2, 265insG, in codon 60, causes a frameshift and premature stop in codon 96 
DPB1*872:01N Insertion
Exon 2, 171insA, in codon 28, causes a frameshift and premature stop in codon 28 
DPB1*873:01N Deletion
Exon 2, 264delG, in codon 59, causes a frameshift and premature stop in codon 59  
DPB1*874:01N Deletion
Exon 2, 298delG, in codon 71, causes a frameshift and premature stop in codon 87 
DPB1*875:01N Deletion
Exon 2, 107delA, in codon 7, causes a frameshift and premature stop in codon 48. 
DPB1*876:01N Insertion
Exon 3, 403insG, in codon 106, causes a frameshift and a premature stop in codon 148 
DPB1*877:01N Point
Exon 2, 262-264TGG>TGA, causes X59, a premature stop in codon 59 
DPB1*878:01N Insertion
Exon 3, 391insC, in codon 102, causes frameshift and premature stop in codon 148 
DPB1*894:01N Deletion
Exon 3, 471delA, in codon 128, causes a frameshift and premature stop in codon 131 
DPB1*911:01N Point
Exon 2, 112-114TTC>TAA, causes X9, a premature stop at codon 9 
DPB1*917:01N Deletion
Exon 2, 192-199delCGTGCGCT, in codons 35-38, causes a frameshift and premature stop at codon 52 
DPB1*919:01N Insertion
Exon 2, 136-139insCTAC, in codon 17, causes a frameshift and premature stop at codon 20 
DPB1*925:01N Insertion
Exon 3, 415-416insAC, in codon 110, causes a frameshift and premature stop at codon 118 
DPB1*939:01 Point
Exon 5, 763-765CGA>TGA, causes R226X, a premature stop in codon 226 
DPB1*941:01N Insertion
Exon 2, 346insC, in codon 87, causes frameshift and premature stop at codon 96 
DPB1*950:01N Point
Exon 3, 409-411CAG>TAG, causes Q108X, a premature stop in codon 108 
DPB1*959:01N Point
Exon 2, 261C>G, causes X58, a premature stop at codon 58 
DPB1*960:01N Deletion
Exon 2, 295delC, in codon 70, causes a frameshift and premature stop in codon 87 
DPB1*974:01N Insertion
Exon 3, 577insC in codon 164, causes frameshift and premature stop in codon 180 
DPB1*984:01N Deletion
Exon 2, 277delG in codon 64, causes a frameshift and premature stop in codon 87 
DPB1*985:01N Point
Exon 3, 367-369CAG>TAG, causes Q94X, a premature stop in codon 94 
DPB1*986:01N Insertion
Exon 3, 403insG, in codon 106, causes frameshift and premature stop in codon 14 
DPB1*995:01N Deletion
Exon 2, 346-352delATGACCC, in codons 87-89, causes frameshift and premature stop in codon 95 
DPB1*1029:01N Deletion
Exon 2, 256delG, in codon 57, causes frameshift and premature stop at codon 87 
DPB1*1041:01N Point
Exon 2, 163-165, GAG>TAG, causes X26, a premature stop at codon 26 
DPB1*1044:01N Point
Exon 2, 316-218, TGC>TGA, causes X77, a premature stop at codon 77 
DPB1*1045:01N Point
Exon 2, 340-342, GAG>TAG, causes X85, a premature stop at codon 85 
DPB1*1070:01N Deletion
Exon 2, 335delT, in codon 83, causes frameshift and premature stop at codon 87 
DPB1*1079:01N Point
Exon 2, 175-177TAC>TAA, causes X30, a premature stop at codon 30 
DPB1*1084:01N Insertion
Exon 2, 189insG, in codon 35, causes a frameshift and premature stop in codon 55 
DPB1*1098:01N Point
Exon 3, 469-471, CGA>TGA, causes X128, a premature stop at codon 128.HLA (2020) 96:249-251
 
DPB1*1112:01N Insertion
Exon 3, 619insA in codon 178, causes frameshift and premature stop at codon 180 
DPB1*1121:01N Point
Exon 2, 361-363CGA>TGA, causes R92X, a premature stop in codon 92 
DPB1*1135:01N Insertion
Exon 2, 286insG, in codon 67, causes a frameshift and premature stop in codon 96 
DPB1*1154:01N Deletion
Exon 2, 248delC in codon 54, causes frameshift and premature stop at codon 87 
DPB1*1169:01N Deletion
Exon 2, 145delT, in codon 19, causes a frameshift and premature stop at codon 48 
DPB1*1191:01N Insertion
Exon 2, 217insG in codon 44, causes frameshift and premature stop at codon 55 
DPB1*1193:01N Deletion
Exon 2, 342delG, in codon 85, causes a frameshift and premature stop in codon 87 
DPB1*1202:01N Point
Exon 3, 583-585GGA>TGA, causes X166, a premature stop at codon 166 
DPB1*1228:01N Deletion
Exon 2, 187delG, in codon 34, causes a frameshift and premature stop in codon 48 
DPB1*1256:01N Point
Exon 3, 469-471CGA>TGA causes X128, causes a premature stop at codon 128 
DPB1*1260:01N Point
Exon 3, 487-490CAG>TAG, causes X134, a premature stop at codon 134 
DPB1*1269:01N Deletion
Exon 3, 488delA, in codon 134, cause a frameshift and premature stop in codon 145 
DPB1*1275:01N Point
Exon 3, 580-583CAG>TAG, causes X165, a premature stop at codon 165 
DPB1*1279:01N Point
Exon 2, 187-189GAG>TAG, causes E34X, a premature stop in codon 34 
DPB1*1285:01N Insertion
Exon 2, 107insA, in codon 7, causes a frameshift and premature stop in codon 7.  
DOA*01:04N Deletion
Exon 2, 108delC, in codon 11, causes frameshift and premature stop at codon 37Tissue Antigens (2005) 66:242-5
 
MICA*063N Point
Exon 2, 184-186CAG>TAG, causes Q39X, a premature stop at codon 39Tissue Antigens (2011) 78:297-298
 
MICA*064N Point
Exon 4, 799-801TGG>TGA, causes W244X, a premature stop at codon 244Tissue Antigens (2012) 79:313-314
 
MICA*088N Point
Exon 4, 754-756CAG>TAG, causes Q229X, a premature stop at codon 229HLA (2019) 94:400-401
 
MICA*096N Deletion
Exon 2, 78-79delCA, in codons 4-5, causes frameshift and premature stop at codon 7 
MICA*107N Deletion
Exon 2, 146-147delTA, in codon 26, causes frameshift and premature stop at codon 36 
MICA*195N Point
Exon 3, 577-579CGA>TGA, causes X170, a premature stop at codon 170 
MICB*009:01:01N Point
Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170Immunogenetics (1997) 46:499-508
 
MICB*009:01:02N Point
Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 
MICB*009:01:03N Point
Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 
MICB*009:01:04N Point
Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 
MICB*009:01:05N Point
Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 
MICB*009:01:06N Point
Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 
MICB*009:01:07N Point
Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 
MICB*009:01:08N Point
Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 
MICB*009:01:09N Point
Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 
MICB*009:01:10N Point
Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 
MICB*009:01:11N Point
Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 
MICB*009:01:12N Point
Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 
MICB*009:01:13N Point
Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 
MICB*009:01:14N Point
Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 
MICB*009:01:15N Point
Exon 3, 577-579CGA>TGA, causes R170X, a premature stop at codon 170 
MICB*021:01:01N Deletion
Exon 2, 205delC, in codon 69, causes frameshift and premature stop at codon 89Tissue Antigens (2004) 64:276-80
 
MICB*021:01:02N Deletion
Exon 2, 205delC, in codon 69, causes frameshift and premature stop at codon 89 
MICB*021:01:03N Deletion
Exon 2, 205delC, in codon 69, causes frameshift and premature stop at codon 89 
MICB*021:01:04N Deletion
Exon 2, 205delC, in codon 69, causes frameshift and premature stop at codon 89 
MICB*021:01:05N Deletion
Exon 2, 205delC, in codon 69, causes frameshift and premature stop at codon 89TBC 
MICB*021:01:06N Deletion
Exon 2, 205delC, in codon 69, causes frameshift and premature stop at codon 89 
MICB*021:01:07N Deletion
Exon 2, 205delC, in codon 69, causes frameshift and premature stop at codon 89 
MICB*041N Deletion
Exon 3, 596delT in codon 176, causes frameshift and premature stop at codon 186 
MICB*043N Deletion
Exon 2, 300delG in codon 77, causes frameshift and premature stop at codon 140 
MICB*045N Point
Exon 4, 955-957TGT>TGA, causes C296X, a premature stop in codon 296 
TAP1*01:02N Deletion
Exon, 599delG, in codon 200, causes frameshift and premature stop at codon 228J Clin Invest (1999) 103:755-8
 

Alternatively Expressed Alleles

Allele Mutation Description of Mutation References
A*01:01:38L Point
Exon 4, 703-705GCG>GCA, causing an aberrant dominant splice site which results in low expressionHuman Immunology (2011) 72:717-722
 
A*01:147Q Point
Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*01:159Q Point
Exon 3, 562-564TGC>GGC, causes C164G, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*01:208Q Point
Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond altering conformation of HLA-A and affecting expressionHLA (2017) 90:79-87
 
A*01:228Q Deletion
Exon 3, 388-393delGACGGG, causes deletion of codons 106-107HLA (2017) 90:79-87
 
A*01:248Q Deletion
Exon 7, 1085-1086delCT, in codon 338, causes frameshift and premature stop at codon 339, which may affect expression 
A*01:281Q Point
Exon 1, 1-3ATG>ATT, causes a non-synonymous change to the start codon, which may affect expression 
A*01:301Q Point
Intron 2, g708G>A, causes a mutation in the splice site prior to exon 3 
A*01:396Q Point
Exon 3, 562T>A, causes C164S, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*02:01:01:02L Point
Promoter Region, g-101T>C, causes a mutation in the Enhancer B region of the promoterHum Immunol (1994) 41:69-73
Tissue Antigens (2006) 68:442-5
 
A*02:01:01:134Q Point
Intron 2, g475T>C, causes a mutation in the splice site proceeding exon 2, which may affect expression.  
A*02:01:14Q Point
Exon 4, 703-705GCG>GCA, causing an aberrant dominant splice site, which may affect expressionHLA (2018) 91:175-186
 
A*02:293Q Point
Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-A and affecting expressionTissue Antigens (2011) 78:267-270
 
A*02:437Q Point
Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*02:440Q Point
Exon 3, 562-564TGC>CGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*02:500Q Point
Exon 3, 562-564TGC>CGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*02:581Q Point
Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*02:605Q Point
Exon 3, 373-375TGC>TGG, causes C101Y, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*02:618Q Deletion
Exon 3, 520-531delGCCCATGTGGCG, a deletion of codons 150-153, which may affect expression 
A*02:672Q Point
Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond altering conformation of HLA-A and affecting expressionHLA (2019) 94:59-60
 
A*02:728Q Point
Exon 3, 373-375TGC>GGC, causes C101G, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*02:795Q Point
Exon 1, 1-3ATG>TTG, causes a non-synonymous change to the start codon, which may affect expression 
A*02:805Q Deletion
Exon 2, 288-290delGAC, causes deletion of codon 73, which may affect expression 
A*02:826Q Deletion
Exon 2, 214-222delCGGGCGCCG, causes deletion of codons 48-50, which may affect expression 
A*02:827Q Deletion
Exon 2, 149-157delGCTACGTGG, causes deletion of codons 26-28, which may affect expression 
A*02:997Q Point
Exon 3, 373-375TGC>AGC, causes C101S, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*02:1007Q Point
Exon 6, 1030-1032TAC>TAG, causes Y320X, a premature stop in codon 320 
A*02:1011Q Point
Exon 1, 1-3ATG>GTG, causes a non-synonymouse change to the start codon, which may change expression 
A*03:234Q Deletion
Exon 3, 520-531delGAGGCGGCCCAT, a deletion of codons 150-153, which may affect expression 
A*03:388Q Insertion
Exon 3, 438-440insTTA, causes insertion of codon 124, which may affect expression 
A*11:50Q Point
Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*11:52Q Deletion
Exon 2, 103-105delTCC, causes deletion of codon 11, this change affects the disulphide bond altering conformation of HLA-A and affecting expressionTissue Antigens (2011) 78:195-202
 
A*11:170Q Point
Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-A and affecting expressionHLA (2017) 90:171-173
 
A*11:182Q Point
Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*11:235Q Deletion
Exon 2, 118-123delGGCCGC, causes deletion of codons 16-17, which may affect expressionHLA (2016) 87:456-458
 
A*11:256Q Deletion
Exon 3, 409-417delTACCGGCAG, causes deletion of codons 113-115HLA (2017) 89:302-304
 
A*11:272Q Deletion
Exon 2, 167-175delCAGTTCGTG, causes the deletion of codons 32-34 
A*11:313Q Deletion
Exon 1, 30-32delCCT, causes deletion of codon -15, which may affect expression 
A*11:351Q Insertion
Exon 3, 595-603insCTGGAGAAC, causes insertion of codons 175-177, which may affect expression 
A*11:375Q Point
Cysteine at 101 changed to Serine. Disulphide bond disrupted and this may affect expression. 
A*23:107Q Point
Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*24:02:01:02L Point
Intron 2, g708G>A, causes a mutation in the splice site prior to exon 3J Immunol (1997) 158:5242-50
Tissue Antigens (1997) 50:340-6
Transplantation (1999) 67:1336-41
Tissue Antigens (2004) 63:589-91
 
A*24:02:01:17Q Point
Intron 7, g2897A>C, causes a mutation in the splice site prior to exon 8, which may affect expression 
A*24:02:03Q Point
Exon 4, 703-705GCG>GCA, causing an aberrant dominant splice site, which may affect expressionTissue Antigens (2003) 61:325-9
 
A*24:294Q Deletion
Exon 2, 325-327delTAC, a deletion of codon 85, which may affect expression 
A*24:329Q Point
Exon 3, 373-375TGC>CGC, causes C101R, this change affects the disulphide bond altering conformation of HLA-A and affecting expressionHLA (2019) 95:128-130
 
A*24:378Q Point
Exon 3, 562-564TGC>GGC, causes C164G, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*24:447Q Point
Intron 2, g475T>C, causes a mutation in the splice site proceeding exon 2 
A*24:450Q Point
Intron 2, g708G>A, causes a mutation in the splice site prior to exon 3 
A*24:473Q Insertion
Exon 1, 57insGCCCTG, causes insertion of codons -6 and -5, which may affect expression 
A*24:479Q Point
Exon 1, 1-3ATG>AAG, causes M>K, this change affects the start codon, which may affect expression 
A*24:513Q Point
Exon 5, 1009-1010C>A, causes Y313X, a premature stop in codon 313 
A*24:536Q Deletion
Exon 2, 232-235delCAG, causes the deletion of codon 55, which may affect expression 
A*26:166Q Point
Exon 7, 1090-1092AAA>TAA, causes X340, a premature stop in codon 340 
A*29:126Q Insertion
Exon 3, 491-532insTGGCGGCTCAGATCACCCAGCGCAAGTGGGAGGCGGCCCGTG, in codon 154, which may affect expression 
A*30:14L Point
Exon 3, 562-564TGC>TCC, causes C164S, this change affects the disulphide bond altering conformation of HLA-A and affecting expressionHuman Immunology (2006) 67:589-596
 
A*30:101Q Point
Exon 3, 373-375TGC>TGG, causes C101R, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*30:184Q Insertion
Exon 3, 417insTTC causes 116insS which may affect expression 
A*31:01:02:30Q Point
Intron 7, g2730G>T, causes a mutation in the splice site proceeding exon 7, which may affect expression 
A*31:151Q Point
Exon 7, 1060-1062CAG>TAG, causes X330, a premature stop at codon 330, which may affect expression 
A*31:206Q Point
Exon 3, 563G>T, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*32:11Q Point
Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expressionTissue Antigens (2006) 68:518-20
Human Immunology (2018) 79:763-772
 
A*32:101Q Point
Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*33:03:01:21Q Point
Intron 1, g75G>T, causes a mutation in the splice site proceeding exon 1, which may affect expression 
A*33:03:03Q Point
Exon 4, 703-705GCG>GCA, causing an aberrant dominant splice site, which may affect expressionTissue Antigens (2009) 74:432-434
 
A*33:175Q Deletion
Exon 2, 239-244delGGCCGG, causes the deletion of codons 56-57, which may affect expression 
A*66:26Q Point
Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
A*68:148Q Point
Exon 3, 562-564TGC>AGC, causes C164S, this change affects the disulphide bond altering conformation of HLA-A and affecting expressionHLA (2017) 90:79-87
 
A*68:159Q Deletion
Exon 2, 328-330delAAC, causes deletion of codon 86HLA (2017) 90:79-87
 
A*68:263Q Insertion
Exon 4, 741insGAC, causes 224insD, which may affect expression 
A*68:276Q Deletion
Exon 3, 547delTAC, in codon 159, causes 159delY, which may affect expression 
B*07:360Q Point
Exon 3, 562-564TGC>CGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-B and affecting expression 
B*07:426Q Insertion
Exon 3, 478insinsAGGACCTGCGCTCCTGGACCGCCG in codons 136, causes insertion of EDLRSWTA, which may affect expression. 
B*08:270Q Point
Exon 1, 1-3ATG>GTG, causes a non-synonymous change to the start codon, which may affect expression 
B*08:284Q Insertion
Exon 3, 491ins GGACACCGCGGC in codon 141, causes insertion of DTAA, which may affect expression.  
B*13:08 Point
Exon 3, 547-549TAC>TGC, causes Y159C, this change affects the disulphide bond altering conformation of HLA-B and affecting expression 
B*13:123Q Point
B*13 novel allele with mutation in stop codon, resulting in extension of CDS sequence by 24bp/8aa 
B*14:70Q Point
Exon 3, 562-564TGC>TCC, causes C164S, this change affects the disulphide bond altering conformation of HLA-B and affecting expression 
B*15:01:01:39Q Point
Intron 1, g201G>C, causes a mutation in the splice site preceeding exon 2, which may affect expression 
B*15:218Q Point
Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond altering conformation of HLA-B and affecting expressionTissue Antigens (2014) 83:184-189
 
B*15:245:01Q Point
Exon 3, 562-564TGC>TTT, causes C164F, this change affects the disulphide bond altering conformation of HLA-B and affecting expression 
B*15:245:02Q Point
Exon 3, 562-564TGC>TTT, causes C164F, this change affects the disulphide bond altering conformation of HLA-B and affecting expression 
B*15:321Q Deletion
Exon 4, 742-753delCAAACTCAGGAC, a deletion of codons 224-227, which may affect expression 
B*15:377Q Deletion
Exon 2, 325-327delTAC, a deletion of codon 85, which may affect expressionHLA (2018) 92:304-309
 
B*15:520Q Insertion
Exon 2, 328-330insTAC, causes the insertion of codon 86, which may affect expression 
B*15:546Q Deletion
Exon 1, 25-27delGTC, causes the deletion of codon -16, which may affect expression 
B*15:616Q Point
Intron 2, 473G>C causes a mutation in the splice site proceeding exon 2, which may affect expression 
B*18:01:01:12Q Point
Intron 2, g716G>C, causes a mutation in the splice site prior to exon 3, which may affect expression 
B*18:01:01:42Q Point
Intron 2, g715A>G, causes a mutation in the splice site prior to exon 3, which may affect expression. 
B*18:106Q Point
Exon 3, 562-564TGC>GGC, causes C164G, this change affects the disulphide bond altering conformation of HLA-B and affecting expressionHLA (2016) 87:31-35
 
B*27:05:02:04Q Point
Intron 2, g716G>A, affecting splice site for exon 3, which may affect expressionHLA (2018) 91:187-194
 
B*27:185Q Point
Exon 3, 562-564TGC>GGC, causes C164G, this change affects the disulphide bond altering conformation of HLA-B and affecting expression 
B*35:65Q Point
Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-B and affecting expressionImmunogenetics (2006) 58:929-31
Immunogenetics (2006) 58:929-31
 
B*35:333Q Point
Exon 3, 563G>A, causes C164Y, this change affects the disulphide bond altering conformation of HLA-B and affecting expression 
B*35:428Q Insertion
Exon 2, 143-157insAGCCCCGCTTCATCG, causes the insertion of codons 24-28, which may affect expression 
B*35:460Q Point
Not found to be expressed on cell surfaceHLA (2021) 97:361-362
 
B*37:16Q Point
Exon 3, 562-564TGC>TAG, causes C164Y, this change affects the disulphide bond altering conformation of HLA-B and affecting expressionTissue Antigens (2014) 83:184-189
 
B*38:01:01:03Q Deletion
Intron 2, g472delG, affecting splice site for exon 2, which may affect expression 
B*38:55Q Point
Exon 3, 373-375TGC>CGC, causes C101R, this change affects the disulphide bond altering conformation of HLA-B and affecting expressionInt. J. Immunogenetics (2015) 42:294-296
 
B*38:68L Deletion
Exon 4, 760-768delCTTGTGGAG, causes deletion of codons 229-231, which may affect expressionScientific Reports (2019) 9:8067-8067
 
B*38:173Q Point
Exon 3, 5620564TGC>TAC, causes C164Y, this change affects the disuphide bond altering conformation of HLA-B and affecting expression 
B*39:01:01:02L Deletion
Promoter region, g-151-152delTC, causes a decrease in promoter activity and low expression of the allele is seen 
B*39:38Q Point
Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-B and affecting expressionTissue Antigens (2006) 68:518-20
HLA (2017) 89:159-162
 
B*39:150Q Point
Exon 1, 1-3ATG>AGG, causes M1V, this change affects the start codon, which may affect expression 
B*40:133Q Point
Exon 3, 562-564TGC>CGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-B and affecting expressionTissue Antigens (2014) 83:184-189
 
B*40:421Q Deletion
Exon 2, 211-219delGCGGGCGCC, causes the codons of codons 47-49, which may affect expression 
B*41:56Q Point
Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond altering conformation of HLA-B and affecting expression 
B*44:02:01:02S Point
Intron 4, g1934A>G, causes an incorrect splicing leading to the deletion of exon 5Tissue Antigens (2004) 63:173-80
 
B*44:02:01:13Q Point
Intron 3, g994T>C, causes a mutation in the splice site proceeding exon 3, which may affect expression. 
B*44:02:01:39 Point
5' UTR, g-1G>C, causes a mutation in the splice site prior to exon 1 
B*44:138Q Deletion
Exon 3, 353-355delCCC, causes deletion of codon 94, this change affects the disulphide bond altering conformation of HLA-B and affecting expressionHLA (2019) 93:89-96
 
B*44:160Q Point
Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond altering conformation of HLA-B and affecting expression 
B*44:480Q Deletion
Exon 3, 589-594delGAGAAC, causes the deletion of codons 173-174, which may affect expression 
B*46:51Q Point
Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-B and affecting expressionHLA (2017) 90:171-173
 
B*51:173Q Point
Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
B*51:329Q Insertion
Exon 1, 11ins CGGCGCCCCGAACCGTCC, causes insertion of codons -20--15, which may affect expression 
B*51:346Q Insertion
Exon 3, 430insACG in codon 120, causes insertion of D, which may affect expression 
B*56:01:01:05S Point
Intron 4, g1935A>G, causes an incorrect splicing leading to the deletion of exon 5HLA (2018) 92:250-251
 
B*57:98Q Point
Exon 3, 373-375TGC>GGC, causes C101G, this change affects the disulphide bond altering conformation of HLA-B and affecting expression 
C*01:121Q Point
Exon 3, 562-564TGC>AGC, causes C164S, this change affects the disulphide bond altering conformation of HLA-C and affecting expression 
C*01:185Q Deletion
Exon 5, 965-972delCTGTCCTAG, causes deletion of codons 298-300, which may affect expression 
C*02:02:02:34Q Point
Intron 3, g996G>T, causes a mutation in the splice site after exon 3 
C*02:25Q Point
Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
HLA (2017) 90:79-87
 
C*02:67Q Point
Exon 3, 373-375TGC>GGC, causes C101G, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2014) 83:184-189
 
C*02:205Q Insertion
Exon 5, 1000insGT in codon 309, causes frameshift and premature stop in the 3'UTR region.  
C*03:03:01:39Q Point
Intron 3, g997T>A, causes a mutation in the splie site proceeding exon 3, which may affect expression 
C*03:03:01:55Q Point
Intron 2, g720G>C, causes a mutation in the splice site prior to exon 3 
C*03:04:01:35Q Point
Intron 3, g996G>A, causes a mutation in the splice site after exon 3 
C*03:22Q Point
Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2006) 67:343-5
 
C*03:169Q Point
Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2014) 83:184-189
 
C*03:244Q Point
Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
C*03:442Q Point
Exon 1, 1-3ATG>GTG, causes a non-synonymous change to the start codon, which may affect expression 
C*03:448Q Insertion
Exon 2, 223-237insTGGGTGGAGCAGGAG, causes 56-60insWVEQE, which may affect expression 
C*04:01:01:47Q Point
Intron 4, g1860T>G, causes a mutation in the splice site after exon 4 
C*04:01:01:84Q Point
Intron 5, g2538G>C, causes a mutation in the splice site prior to exon 6, which may affect expression 
C*04:59Q Point
Exon 3, 562-564TGC>TAG, causes C161Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
 
C*04:338Q Point
Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-C and affecting expression 
C*04:382Q Point
Exon 3, 562-564TGC>CGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-C and affecting expression 
C*04:428Q Point
Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond althering conformation of HLA-C and affecting expression  
C*04:456Q Deletion
Exon 7, 1072delGATGAGTCTCT, causes a frameshift and premature stop in codon 337 
C*05:01:01:53Q Point
Intron 1, g203G>A, causes a mutation in the splice site prior to exon 2, which may affect expression 
C*05:51Q Deletion
Exon 3, 553-567delGAGGGCACGTGTGCGTG, causes deletion of codons 161-165, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionHLA (2017) 90:79-87
 
C*05:202Q Deletion
Exon 2, 91-105delTATTTCTACACCGCC, causes deletion of codons 91-95, which may affect expression 
C*06:74Q Point
Exon 3, 562-564TGC>GGC, causes C164G, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2014) 83:184-189
 
C*06:200Q Point
Exon 3, 562-564TGC>TTC, causes C164F, this change affects the disulphide bond altering conformation of HLA-C and affecting expression 
C*06:285Q Point
Exon 1, 1-3ATG>ATA, causes a non-synonymous change to the start codon, which may affect expression 
C*06:326Q Point
Exon 3, 373-375TGC>AGC, causes C101S, this change affects the disulphide bond altering confirmation of HLA-C and affecting expression 
C*07:01:01:14Q Point
Intron 1, g203C>G, affecting splice site for exon 2, which may affect expressionHLA (2018) 91:187-194
Human Immunology (2018) 79:763-772
 
C*07:01:01:100Q Point
Intron 2, 718A>G, causes a mutation in the splice site preceeding exon 3, which may affect expression 
C*07:02:01:74Q Point
Intron 2, g2727G>A, causes a mutation in the splice site after to exon 7 
C*07:02:01:124Q Point
Intron 6, g2679G>A causes a mutation in the splice sites at the end of intron 6, which may affect expression 
C*07:02:01:125Q Point
Intron 3, 1002T>C causes a mutation in splice site proceeding exon 2, which may effect expression. 
C*07:02:01:137Q Point
Intron 2, g720G>A, causes a mutation in the splice site preceeding exon 3, which may affect expression 
C*07:04:01:15Q Point
Intron 2, 718A>G, causes a mutation in the splice site preceeding exon 3, which may effect expression 
C*07:04:01:16Q Point
Intron 1, 203G>C, causes a mutation in the splice site priot to exon 2 
C*07:06:01:05Q Point
Intron 5, g2537G>A, causes a mutation in the splice site prior to exon 6 
C*07:121Q Point
Exon 3, 562-564TGC>CGC, causes C164F, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
 
C*07:150Q Insertion
Exon 3, 499-500insCCCAGCGCAAGGTCAGATCAC, in codon 143, this change may affect the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2012) 79:50-57
 
C*07:226Q Point
Exon 3, 373-375TGC>AGC, causes C101S, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2014) 83:184-189
HLA (2017) 90:79-87
 
C*07:235Q Point
Exon 3, 562-564TGC>TCC, causes C164S, this change affects the disulphide bond altering conformation of HLA-C and affecting expression 
C*07:432Q Point
Exon 3, 373-375TGC>CGC, causes C101R, this change affects the disulphide bond altering conformation of HLA-C and affecting expression 
C*07:494Q Point
Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expression 
C*07:513Q Point
Exon 3, 562-564TGC>TGG, causes C164W, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionHLA (2017) 90:79-87
 
C*07:582Q Point
Exon 3, 373-375TGC>GGC, in codon 101, causes C101G, this change affects the disulphide bond altering conformation of HLA-C and affecting expression 
C*07:632Q Deletion
Exon 3, 598-600delAAG, causes deletion of codon 176, which may affect expressionHLA (2018) 92:233-234
 
C*07:663Q Deletion
Exon 2, 217-225delGCGCCGTGG, causes a deletion of codons 49-51, which may affect expression 
C*07:697Q Point
Exon 3, 373-375TGC>TGG, causes C101W, this change affects the disulphide bond altering conformation of HLA-C and affecting expression 
C*07:713Q Point
Exon 3, 373-375TGC>AGC, causes C101S, this change affects the disulphide bond altering conformation of HLA-C and affecting expression 
C*07:819Q Insertion
Exon 3, 556-591insGGCACGTGCGTGGAGTGGCTCCGCAGATACCTGGAG, causes insertion of codons 173-184, which may affect expression 
C*07:974Q Deletion
Exon 2, 121-124delCGC, causes 18delR, which may affect expression 
C*08:70Q Point
Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2014) 83:184-189
 
C*08:141Q Point
Exon 3, 375C>G, causes C101W, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionHLA (2017) 90:79-87
 
C*08:225Q Deletion
Exon 5, 978delT in codon 302, causes frameshift and premature stop at codon 303 
C*12:03:01:42Q Point
Intron 3, g996G>A, causes a mutation in the splice site proceeding exon 3, which may affect expression 
C*12:42Q Point
Exon 3, 562-564TGC>TGG, causes C164F, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2014) 83:184-189
 
C*12:139Q Point
Exon 3, 562-564TGC>CGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionHLA (2017) 90:79-87
 
C*12:155Q Point
Exon 3, 373-375TGC>TGG, in codon 101, causes C101W, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionHLA (2017) 90:79-87
 
C*12:342Q Deletion
Exon 5, 965-972delGGCTGTCCT, causes deletion of codons 299-301, which may affect expression 
C*12:351Q Deletion
Exon 5, 977delC in codon 302, causes frameshift and premature stop at codon 303. Causes a premature stop in the TM region,  
C*14:105Q Deletion
Exon 3, 548-550delACC, causes deletion of codon 159, which may affect expression 
C*15:02:01:30Q Point
Intron 1, g75T>C, causes a mutation in the splice site proceeding exon 1, which may affect expression 
C*15:02:01:35Q Point
Intron 2, 474G>C, causes mutation in splice site proceeding exon 2, which may affect expression 
C*15:32Q Point
Exon 3, 562-564TGC>GGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-C and affecting expression 
C*15:84Q Deletion
Exon 3, 550-555delCTGGAG, in codons 160-161, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionHLA (2017) 90:171-173
 
C*15:96Q Point
Exon 3, 562-564TGC>TAC, causes C164Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2015) 86:302-303
HLA (2017) 90:79-87
 
C*15:105Q Deletion
Exon 3, 399-401delCCT, a deletion of codon 110, which may affect expression 
C*15:235Q Point
Exon 3, 373-375TGC>TAC, causes C101Y, this change affects the disulphide bond altering conformation of HLA-A and affecting expression 
C*16:16Q Point
Exon 3, 562-564TGC>TAG, causes C164Y, this change affects the disulphide bond altering conformation of HLA-C and affecting expressionTissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
Tissue Antigens (2014) 83:184-189
 
C*16:174Q Point
Exon 3, 562-564TGC>CGC, causes C164R, this change affects the disulphide bond altering conformation of HLA-C and affecting expression 
C*17:01:01:16Q Point
Intron 2, 718A>G, causes a mutation in the splice site preceeding exon 3, which may effect expression 
E*01:68Q Point
Exon 3, 373-375TGC>GGC, causes C101G, this change affects the disulphide bond altering conformation of HLA-E and affecting expressionHLA (2021) 97:389-398
 
G*01:01:01:14Q Point
Intron 1, g201A>G, causes a mutation in the splice site preceeding exon 2, which may affect expression 
G*01:04:01:04Q Point
Intron 4, g1969A>G, causes a mutation in the splice site preceeding exon 5, which may affect expression 
DRB1*01:91Q Deletion
Exon 2, 424-426delAAC, causes deletion of codon 113, which may affect expression 
DRB1*10:38Q Point
DRB1*10 novel allele with a mutation in the stop codon, resulting in extension of CDS sequence by 54bp/18aa 
DRB1*11:248Q Deletion
Exon 2, 285-293delCTTCCTGGA, causes the deletion of codons 66-68, which may affect expression 
DRB1*11:272Q Deletion
Exon 2, 280-282delAAG, causes the deletion of codon 65, which may affect expression 
DRB1*13:278Q Deletion
Exon 2, 193-195delGAG, causes the deletion of codon 36, which may affect expression 
DRB1*14:210Q Insertion
Exon 2, 164-166insGGT, causes the insertion of codon 26, which may affect expression 
DRB1*15:164Q Deletion
Exon 2, 193-195delGAG, causes the deletion of codon 36, which may affect expression 
DRB1*16:59Q Deletion
Exon 2, 320-322delACT, causes the deletion of codon 78, which may affect expression 
DRB3*02:61Q Deletion
Exon 2, 193-195delGAG, causes deletion of codon 36HLA (2017) 90:186-187
 
DRB5*01:79Q Deletion
Exon 2, 119-124delATAAGT, causes the deletion of codons 12-13, which may affect expression 
DQA1*01:07Q Point
Exon 2, 304-306CGC>TGC, causes R79C, which may affect expression.Tissue Antigens (1997) 50:334-9
Hum Immunol (2005) 66:1248-53
Tissue Antigens (2014) 83:49-51
Tissue Antigens (2015) 86:413-418
 
DQA1*01:40Q Deletion
Exon 2, 322-324delGCT, causes deletion of codon 85, which may affect expression 
DQA1*03:03:01:16Q Point
Intron 3, g5159G>A causes a mutation in the splice site preceeding exon 4, which may affect expression 
DQA1*05:29Q Point
Exon 1, 1-3ATG>ACG, causes a non-synonymous change to the start codon, which may affect expression 
DQB1*02:53Q Deletion
Exon 2, 289-291delAAG, a deletion of codon 65, which may affect expressionHLA (2017) 90:79-87
 
DQB1*02:171Q Deletion
Exon 2, 259-261delCTG, in codon 55, which may affect expression 
DQB1*03:01:01:21Q Point
Intron 3, g4627G>A, affecting splice site for exon 3, which may affect expressionHLA (2019) 94:393-394
 
DQB1*03:19:01:02Q Point
Intron 3, g4627G>A, causes a mutation in the splice site after exon 3HLA (2021) 97:171-172
 
DQB1*03:91Q Insertion
Exon 2, 594-595insACTCCCCA, in codon 167, no internal stop codon 
DQB1*03:99Q Deletion
Exon 2, 189-191delCTA, in codon 31>32, no internal stop codonHLA (2017) 90:171-173
 
DQB1*03:197Q Deletion
Exon 2, 277-282delTGGAAC, a deletion of codons 61-62, which may affect expressionHLA (2017) 90:79-87
 
DQB1*05:87Q Deletion
Exon 3, 508-510delGAG, a deletion of codon 138, which may affect expression 
DQB1*05:132Q Deletion
Exon 3, 508-510delGAG, causes deletion of codon 138 
DQB1*06:02:01:18Q Point
Intron 3, g4629G>A, causes a mutation in the splice site proceeding exon 3, which may affect expression 
DQB1*06:416Q Point
Exon 1, 1-3ATG>GTG, causes a non-synonymous mutation in the start codon, which may affect expression 
DPA1*01:03:01:18Q Point
Intron 1, g101G>A, causes a mutation in the splice site, which may affect protein expression 
DPA1*01:21Q Deletion
Exon 2, 298-300delAAC, causes the deletion of codon 69, which may affect expression 
DPA1*01:87Q Point
Exon 1, 1-3ATG>ACG, causes a non-synonymous change to the start codon, which may affect expression. 
DPA1*02:38Q Deletion
Exon 4, 774-775delGG, causes frameshift and results in the extension of CDS by 78bp/26aa 
DPA1*02:56Q Deletion
Exon 2, 208-211delAAG, causes 38delK, which may affect expression 
DPA1*03:05:01:01Q Point
Exon 1, 1-3ATG>ACT, causes a non-synonymous change to the start codon, which may affect expression 
DPA1*03:05:01:02Q Point
Exon 1, 1-3ATG>ACT, causes a non-synonymous change to the start codon, which may affect expression 
DPB1*02:01:02:46Q Point
Intron 4, g10054G>A, causes a mutation in the splice site after exon 4 
DPB1*697:01Q Deletion
Exon 2, 274-276delAAG, in codon 63, causes deletion of codon 63 
DPB1*934:01Q Insertion
Exon 2, 187-189delGAG, causes deletion of codon 34, which may affect expression 
DPB1*935:01Q Insertion
Exon 2, 130-143insACGGCCTACGCGTT, causes 17insLRQECYA, which may affect expression 
DPB1*936:01Q Deletion
Exon 2, 165-170delGAGATA, causes deletion of codons 26 and 27, which may affect expression 
DPB1*1038:01Q Insertion
Exon 3, 636insACC, causes insertion of codon 183, which may affect expression 
DPB1*1092:01Q Deletion
Exon 2, 340-348delGGCGGGCCC in codons 84-86, causes 84-86delGGP, which may affect expression 
DPB1*1148:01Q Deletion
Exon 3, 397-399delAAG, causes 104delK, which may affect expression. 
DPB1*1266:01Q Point
Exon 5, 763-765CGA>TGA, causes R226X, a premature stop in codon 226 
MICA*002:01:13Q Point
Intron 4, g8696 in the 5' end of intron 4, causes a mutation in the splice site, which may affect splicing 
MICA*011:01:04Q Point
Intron 2, g7267G>A, causes a mutation in the splice site proceeding exon 2, which may affect expression 
MICA*105Q Deletion
Exon 3, 607-609delGAG, causes 180delR, which may affect expression 
MICA*171Q Deletion
Intron 2, g7267G>A, causes a mutation in the splice site proceeding exon 2, which may affect expression 

Describing the mutations

The following recommendations are used for describing mutations in nucleotide sequences:

Mutations in protein sequences follow a similar format: